Article Per Year (5 Year)
p-Index From 2020 - 2025
0.61
P-Index
This Author published in this journals
All Journal e-Journal BUDIDAYA PERAIRAN Jurnal Pengabdian kepada Masyarakat Nusantara Agrikan: Jurnal Agribisnis Perikanan JURNAL PENGABDIAN MASYARAKAT YAMASI
Muh. Aris
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Chemical Engineering, Chemistry & Bioengineering Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Environmental Science Health Professions Medicine & Pharmacology Public Health Social Sciences

Published : 4 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 4 Documents
Search

 1 
Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
Coral Reef Conservation: Establishment of Local Communities and Introduction to Coral Lifeform in the Marine Ecotourism Area of Tobololo Beach, Ternate City Ahmad, Aditiyawan; Susanto, Adi Noman; Irham, Irham; Aris, Muh.; Abubakar, Salim; Rumagiar, Zainul Abidin
Agrikan Jurnal Agribisnis Perikanan Vol. 17 No. 2 (2024): Agrikan: Jurnal Agribisnis Perikanan
Publisher : Fakultas Pertanian, Universitas Muhammadiyah Maluku Utara

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.52046/agrikan.v17i2.2250

Abstract

Coral reef conservation has become a topic of growing global attention, in line with the increased awareness of the importance of coral reef ecosystems for marine life and humans. The establishment of environmentally conscious local communities requires a sustainable approach. Training, education, and community empowerment programs need to be implemented to enhance understanding of the importance of coral reefs and to engage the community in conservation efforts. The issue in the ecotourism area of Tobololo Village is the lack of groups or communities that care about coral reefs, mainly because the local community does not yet understand the functions and benefits of coral reef ecosystem services. Community service activities carried out in Tobololo Village included outreach and education, the formation of a local community, and the introduction of coral reefs. The results showed that the outreach activities educated the community about coral reefs, emphasizing that they are living organisms capable of reproduction and that they have both ecological and socio-economic functions and benefits. Additionally, a local community named KOMPAG (Komunitas Masyarakat Peduli Terumbu Karang) was established.
PEMERIKSAAN TEKANAN DARAH, GULA DARAH DAN ASAM URAT SECARA RUTIN MASYARAKAT MALINO TERBEBAS DARI PENYAKIT DEGENERATIF Hafid, Muliana; Andi Muhammad Farid; Muh. Aris; Sulastri; Andi Armisman Edi Paturusi; Deniyati
JURNAL PENGABDIAN MASYARAKAT YAMASI Vol. 4 No. 2 (2025): Jurnal Pengabdian Masyarakat Yamasi
Publisher : Akademi Farmasi Yamasi Makassar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59060/k7kpbh30

Abstract

Non-Communicable Diseases (NCDs) are caused by progressive changes in cell and tissue function, such as coronary heart disease, diabetes mellitus, hypertension, cancer, and osteoporosis. Degenerative diseases such as diabetes mellitus, hypertension, and gouty arthritis are major health problems in society. One preventive measure is early detection through routine health checks, especially blood sugar and uric acid level checks. This community service activity aims to increase public awareness in preventing degenerative diseases through health checks and education. The methods used are direct examinations (random blood sugar and uric acid level screening), blood pressure checks, and health education. The results of the activity showed community participation of 85% of the total invitations, with 32% of participants having above-normal blood sugar levels, and 28% of participants having high uric acid levels. After being given education, 90% of participants stated that they would undergo re-examination and adopt a healthy lifestyle. This activity has a positive impact in increasing public awareness, especially in Malino, about the importance of regular health checks as a step to prevent degenerative diseases
Peningkatan Kapasitas Pembudidaya Ikan dan Udang Dengan Sistem Bioflok di Desa Tuada Kabupaten Halmahera Barat Muchdar, Fatma; Suryani, Suryani; Syazili, Aras; Abdullah, Nursanti; Munaeni, Waode; Yuliana, Yuliana; Juharni, Juharni; Darsan, Ismi Musdalifah; Malan, Sudirto; Adriani, Rovina; Aris, Muh.; Murhum, Mufti Abd; Daud, Asmar Hi; Tamrin, Tamrin; Samadan, Gamal M.
Jurnal Pengabdian kepada Masyarakat Nusantara Vol. 6 No. 4 (2025): Edisi Oktober - Desember
Publisher : Lembaga Dongan Dosen

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55338/jpkmn.v6i4.6267

Abstract

Kegiatan pengabdian kepada Masyarakat, bertujuan untuk meningkatkan pengetahuan dan keterampilan masyarakat khususnya kelompok pembudidaya ikan dan udang tentang budidaya ikan yang efisien dan berkelanjutan. S metode kegiatan pengabdian yaitu dengan memberikan materi dan diskusi aktif dengan peserta kegiatan, materi yang diberikan yaitu budidaya ikan dan udang dengan sistem bioflok. Sistem bioflok dipilih karena memiliki keuntungan dapat menghemat pakan karena mengandung protein dan lemak yang dapat dikonsumsi ikan sebagai tambahan nutrisi. Mengurangi pencemaran air karena limbah organik diubah menjadi biomassa dan sangat efisien dalam pemggunaan air karena tidak perlu sering mengganti air, cocok untuk daerah dengan keterbatasan air dan bisa digunakan dalam kepadatan tinggi karena kualitas air lebih stabil. metode kegiatan ini yaitu pemberian materi dan diskusi interaktif. Hasil dari kegiatan menunjukkan peningkatan pemahaman mereka mengenai konsep dan penerapan sistem bioflok. Peserta secara aktif berdiskusi tentang permasalahan yang mereka hadapi, seperti manajemen kualitas air dan penggunaan pakan, serta solusi praktis yang ditawarkan oleh teknologi bioflok. Kegiatan ini juga memotivasi kelompok pembudidaya ikan dan udang untuk memanfaatkan potensi sumber daya di desa untuk mendukung keberhasilan budidaya. Kegiatan ini diharapkan dapat menjadi langkah awal dalam mendorong penerapan teknologi bioflok secara luas, meningkatkan produksi perikanan, serta mendukung kesejahteraan masyarakat Desa Tuada secara berkelanjutan.
Co-Authors Abdullah, Nursanti Abubakar, Salim Adi Noman Susanto Adriani, Rovina Ahmad, Aditiyawan Andi Armisman Edi Paturusi Andi Muhammad Farid Aras Syazili Darsan, Ismi Musdalifah Daud, Asmar Hi Deniyati Enang Harris Hafid, Muliana Irham Irham Juharni, Juharni Malan, Sudirto Muchdar, Fatma Mufti Abdul Murhum Muh. Fatuhcri Sukadi Rumagiar, Zainul Abidin Samadan, Gamal M Sukenda . SULASTRI Suryani Suryani Tamrin Tamrin WAODE MUNAENI Yuliana Yuliana