Claim Missing Document
Check
Articles

The Chemical Composition of Gracilaria verrucosa Extract and its Utilization on Survival and Growth Litopenaeus vannamei Jasmanindar, Yudiana; Sukenda, Sukenda; Alimuddin, Alimuddin; Junior, Muhammad Zairin; Utomo, Nur Bambang Priyo
Journal Omni-Akuatika Vol 14, No 3 (2018): Omni-Akuatika November
Publisher : Fisheries and Marine Science Faculty - Jenderal Soedirman University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (686.335 KB) | DOI: 10.20884/1.oa.2018.14.3.508

Abstract

The Gracilaria genus is a potential source of natural and environmentally-friendly alternatives in improving the survival and growth of shrimp. This study aims to identification immunostimulant molecules extract G. verrucosa and evaluate the utilization of G verrucosa extract as an immunostimulant in improving survival and growth of L. vannamei. Seaweed extraction used ethyl acetate then formulated in the diets. The immunostimulant molecule in the G. verrucosa was analysis. The shrimp were fed a test diet containing extract G. verrucosa at a dose of 2 g kg-1 or extract G. verrucosa-free control diets for 42 days. Shrimps were fed diets containing extract with a specific duration. The observation on the survival and growth of L. vannamei was performed after maintenance at the Laboratory for six weeks. Following, diets containing extract was tested in the field (pond shrimp farm) at the same dose of extract for 58 days. Shrimp was feed diets containing extract once a week, once in the early culture, and diet control, then the survival and growth shrimp were analysis. Concentrations of sulfates and carbohydrates in G. verrucosa ethyl acetate-extract were 24.21% and 13.41%, and crude protein 3.64%. GC-MS pyrolysis results show that G. verrucosa polysaccharide is similar to immunostimulant molecules. The survival shrimp gave diets containing G. verrucosa extract formulation was higher than that of shrimps fed controls diet. The Shrimp fed diets extracts have higher growth than shrimp given control dietsKeywords: Gracilaria, extract, polysaccharides, immunostimulant
Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
Toksisitas Produk Ekstrasellular (ECP) Streptococcus agalactiae pada Ikan Nila (Oreochromis niloticus) Hardi, Esti Handayani; Sukenda, Sukenda; Harris, Enang; Lusiastuti, Angela Mariana
Jurnal Natur Indonesia Vol 13, No 3 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (919.679 KB) | DOI: 10.31258/jnat.13.3.187-199

Abstract

This research aimed to know the toxicity of extracellular products (ECP) of Streptococcus agalactiae was tastedin cultured Nile tilapia (Oreochromis niloticus). Streptococcus agalactiae had two haemolytic types: β-haemolyticand non-haemolytic type. Toxicity test of ECP to know the virulancy factor of S. agalactiae was still limited. It wasfound that after tested on 15 fish weighing 15 g through intraperitoneal injection 0,1 ml/fish, both bacteria causedchanges in swimming pattern, palatability, external and internal anatomy macroscopically and microscopically.Extracellular products of S. agalactiae non-haemolytic type (BHIA and BHI 24 h) and β-haemolytic type (BHI 72 h)caused mortality 12 hours after injection and the mortality continued till day 7 th of culture. Whirling happened 96hours after injection with ECP S. agalactiae β-haemolytic type (BHIA 72 h incubation) whereas injection with ECP(BHI 24 h) on 72 h after injection and continued untill day 7 th. Behavior disease signs caused by S. agalactiaeoccured on eyes. There were opacity, purulens, eye shrink, lateral and bilateral exopthalmia and haemorrhage oninfected-fish. Silver staining of sodium dodecyl sulphate-polyacrylamide gels to S. agalactiae revealed thatpredominant 51.8-69.6 kDa bands were present in BHIA ECP fraction. The 69.6 kDa was absent from the BHI ECP.Total protein on non-haemolytic S. agalactiae ECP are 28.18 ppm on BHIA medium and 13.64 ppm on BHI medium.Whereas β-haemolytic S. agalactiae ECP are 2.73 ppm on BHIA medium and 8.18 ppm on BHI medium. Concentrationof protein in ECP was one of factor that caused non-haemolytic S. agalactiae more virulent than β-haemolytic type.The conclusion from the research that ECP was virulent factor on β-haemolytic and non-haemolytic S. agalactiaein fish which caused changes in behavior disease signs.
Construction of a DNA Vaccine Using Glycoprotein Gene and Its Expression Towards Increasing Survival Rate of KHV-Infected Common Carp (Cyprinus carpio) Nuryati, Sri; Alimuddin, Alimuddin; Sukenda, Sukenda; Soejoedono, Retno Damayanti; Santika, Ayi; Pasaribu, Fachriyan Hasmi; Sumantadinata, Komar
Jurnal Natur Indonesia Vol 13, No 1 (2010)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (120.942 KB) | DOI: 10.31258/jnat.13.1.47-52

Abstract

Deoxyribonucleic acid (DNA) vaccine has recently been developed as an alternative vaccine against virus infection.This study was the first step of DNA vaccine development to protect cyprinids including common carp (Cyprinuscarpio) and fancy koi (Cyprinus carpio) from KHV (koi herpesvirus) infection in Indonesia. One of KHV glycoproteingenes, i.e. glycoprotein (GP) was ligated with Japanese medaka (Oryzias latipes) â-actin promoter to generatepAct/GP as a DNA vaccine. Fourty fish in body weight of 10-15 g/fish were individually injected by pAct/GP intomuscle in different dosage of 2.5 μg, 7.5 μg and 12.5 μg/100 μl phosphate buffer saline. Total RNA was extractedfrom the 12.5 μg of pAct/GP-injected fish muscle at 24, 48 and 67 hours post-injection to analyze GP expression byRT-PCR method. Potential of pAct/GP as DNA vaccine was examined by injecting KHV into the 30-days-vaccinatedfish. Both of possitive and negative control fish group were not vaccinated. Possitive control fish group wereinjected with KHV, but negative control fish group were not. KHV-challenged fish were reared for 1 month, and thedeath fish were calculated daily. Result of RT-PCR analysis showed that GP gene expression were detected at 3 dpost-injection. Expression of GP in the vaccinated fish groups helped to improve their survival rate after challengedby KHV. All of fish without DNA vaccination had dead 17 days after KHV injection. The results demonstrated thatpAct/GP had high potency to be used as a DNA vaccine against KHV infection in cyprinids.
Strategi Penerapan Ecosystem Approach To Aquaculture (EAA) Komoditas Udang di Kabupaten Pinrang Sulawesi Selatan eddy supriyono; Wisriati Lasima; Muhammad Zairin Junior; Sugeng Budiharsono; Kukuh Nirmala; Sukenda
Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (Journal of Natural Resources and Environmental Management) Vol. 11 No. 3 (2021): Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (JPSL)
Publisher : Graduate School Bogor Agricultural University (SPs IPB)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jpsl.11.3.504-512

Abstract

This study aims to develop a strategy for the sustainability of shrimp aquaculture using an ecosystem approach or EAA in Pinrang Regency, South Sulawesi. A series of analyzes were carried out, namely the environmental carrying capacity analysis of aquaculture using pond environmental feasibility standards, analysis of critical factors for the sustainability of aquaculture using multidimensional scaling analysis, analysis of the sustainability status of aquaculture using pairwise comparison analysis and analysis of shrimp aquaculture management strategies based on EAA. using hierarchy process analysis. The results showed that the following strategies were needed: a) accelerating spatial planning and implementing programs in accordance with the directions for spatial use and control; b) institutional strengthening of capital cultivators in order to complement and improve facilities and infrastructure in accordance with the SOP; and c) increasing the level of education and providing a social and economic security system for members of the shrimp farming community
Nursery Culture Performance of Litopenaeus vannamei with Probiotics Addition and Different C/N Ratio Under Laboratory Condition . WIDANARNI; DEBY YUNIASARI; . SUKENDA; JULIE EKASARI
HAYATI Journal of Biosciences Vol. 17 No. 3 (2010): September 2010
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (183.015 KB) | DOI: 10.4308/hjb.17.3.115

Abstract

Application of bioflocs technology and probiotics has improved water quality and production of Pacific white shrimp (Litopenaeus vannamei) culture. This experiment was to verify the effect of probiotic bacteria addition and different carbon:nitrogen (C:N) ratio on water quality and performance of Pacific white shrimp nursery culture. Nursery culture was carried out for 25 days in an aquarium under laboratory condition with stock density of one Post-Larvae (PL) (poslarval) per liter (24 PL/aquarium) of PL16 shrimp. Different C:N ratio resulted a significant difference on shrimp production performance. Treatment of 10 C:N ratio demonstrated the best shrimp growth (20.37 + 0.48% per day in weight and 6.05 + 0.41% per day in length), harvesting yield (1180 + 62 g/m3) and feed efficiency (121 + 6%). There was however no significant difference observed between treatments in water quality.
Bakteri Probiotik Dalam Budidaya Udang: Seleksi, Mekanisme Aksi, Karakterisasi, dan Aplikasinya Sebagai Agen Biokontrol Widanarni Widanarni; Sukenda Sukenda; Mia Setiawati
Jurnal Ilmu Pertanian Indonesia Vol. 13 No. 2 (2008): Jurnal Ilmu Pertanian Indonesia
Publisher : Institut Pertanian Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (348.509 KB)

Abstract

Bacterial disease attack occurs at the hatchery stage, which is considered to be the most serious threat, and often results in mass mortality of shrimp larvae by vibrosis which is that caused by a luminous bacterium identified as Vibrio harveyi. This research was carried out to obtain local isolates of probiotic bacteria that were able to inhibit the growth of V. harveyi and effectively apply it as a biocontrol of vibriosis in shrimp cultures. The research was carried out as follows: (1) In vitro and in vivo selection of probiotic bacteria candidates, (2) Study of the action mechanism and characterization of the selected pro biotic bacteria, (3) Study on application of the selected probiotic bacteria as a biocontrol agent in shrimp cultures. Results of in vitro and in vivo selection provided the best three isolates, which were 1Ub, SKT-b and Ua. The survival rate of shrimp larvae which were not only inoculated by V. harveyi but also with 1Ub, SKT-b and Ua probiotic bacteria were 88.33, 83.33, and 81.67% respectively; where as the positive control treatment (merely inoculated with V. harveyi) gave a 41.67% survival rate and the negative control (without bacterial addition) was 68.33%. Studies using a rifampicin resistant marker (RfR) demonstrated that the number of V. harveyi MR5339 RfR cells in treatments without probiotic addition were higher than the treatment with the probiotic bacteria, in dead larvae, living larvae, as well as in the culture media. Partial sequencing of the I6S-rRNA gene showed that the I Ub isolate was similar to Pseudoalteromonas piscicida, whereas the SKT -b and Ua isolates were similar to Vibrio alginolyticus. Selected probiotic bacteria could be applied directly to shrimp larva culture media, or orally through enrichment of both natural and artificial food. Keywords: Penaeus monodon larvae, probiotic bacteria, vibriosis 
Benih Keturunan Induk Ikan Nila yang Divaksinasi pada Tingkat Kematangan Gonad-2 Lebih Tahan Terhadap Infeksi Streptococcus agalactiae (RESISTANCE OF TILAPIA (OREOCHRIMIS NILOTICUS) FRY VACCINATED AT DIFFERENT GONADAL DEVELOPMENTAL STAGES TOWARD STREPTOCO Khairun Nissa; Sukenda Sukenda; Muhammad Zairin Junior; Angela Mariana Lusiastuti; Sri Nuryati
Jurnal Veteriner Vol 17 No 3 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (214.666 KB)

Abstract

The aim of this study was to evaluate the effectiveness of vaccination based on gonad maturationstages on tilapia brood stocks in which the released antibodies was able to be transferred to the seed.Vaccine composed with whole cells and extracellular product (ECP) was injected at stage 2 and stage 3 ofthe gonad development stages at concentration of 109 CFU mL1 as much as 4 mL to 1 kg of brood fish.Control fish was unvaccinated treatment. Challenge study at seed was conducted by immersing S. agalactiaefor 30 minutes at 7, 14, 21, and 28 days post hatching (DPH) in 107 CFU/mL. Antibody levels on broodstocks, eggs, and body fluids of seed, and relative percentage survival (RPS) of seed post challenge studywere evaluated. The results showed that stage 2 of gonad developmental stages was found on 7 days postinitial spawning and stage 3 found on 14 days post initial spawning of brood fish. Vaccinated done in stage 2 of gonad developmental stages gave immunoglobulin serum in brood (0,166±0,001), egg (0,165±0,002),and seed aged 7, 14, 21, and 28 days post hatching (0,164±0,002, 0,162±0,005, 0,155±0,006, and 0,14±0,008respectively) were significantly higher (P<0,05) compared to other treatment. Challenged test that doneby immersing with S. agalactiae suspension on larval aged 7, 14, 21, and 28 days had highest RPS(95,24%, 83,33%, 72,22%, and 56,02% respectively) formed on seed from brood stock vaccination in gonaddevelopment stage 2. Vaccination in tilapia brood stocks at stage 2 of gonad developmental stages gavehighest protection by maternal immunity to the seed against S. agalactiae.
Karakteristik dan Patogenisitas Streptococcus Agalactiae Tipe ?-hemolitik dan Non-hemolitik pada Ikan Nila Esti Handayani Hardi; Sukenda -; Enang Harris; Angela Mariana Lusiastuti
Jurnal Veteriner Vol 12, No 2 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1022.628 KB)

Abstract

Streptococcus agalactiae was isolated from cultured Nile tilapia (Oreochromis niloticus) in Cirata gulfand Klaten. The isolates were Gram positive cocci, oxidative fermentative positive, motility, and catalasenegative, grown on media containing NaCl 6.5%, ?-haemolytic and non-haemolytic. Two types of S. agalactiae(?-haemolytic and non-haemolytic) are different from their variety of sugars fermentation. Strains ?-haemolytic can ferment more sugars, including arabinose, sorbitol, lactose, and trehalose. Experimentalinfectivity trials on Nile tilapia (size 15 g), non-haemolytic type showed more virulent. This type causedfaster mortality, more severe behavior changes, and pathology changes than â-haemolytic type. NonhemoliticS. agalactiae caused 48% mortality 6-24 hours after injection, whereas â-haemolitic type caused17% mortality which it occured in 48 hours after injection (mortality of fish control 2,22%). Behaviordisease signs caused by non-haemolitic S. agalactiae started to happen 6 hours after injection whereas 12hours in ?-haemolytic type infection. Histopatological changes were observed on fish eye, spleen, andbrain. Hyperaemia, hyperthrophi, degeneration, and necrosis were also found on infected fish. Thisresearch was concluded that non-haemolytic of S. agalactiae was more virulent than ?-haemolytic.
Aplikasi Probiotik Bacillus NP5 Bentuk Segar dan Mikrokapsul Untuk Pencegahan Infeksi Aeromonas hydrophilla Pada Ikan Mas (Cyprinus caprio) (Application of the Fresh Culture and Microencapsulated of Bacillus NP5 Probiotic to Prevent Aeromonas hydrophilla infection on Common Carp (Cyprinus carpio)) Widanarni Widanarni; Alit Brilliant; Sukenda Sukenda
Jurnal Sains Terapan : Wahana Informasi dan Alih Teknologi Pertanian Vol. 4 No. 2 (2014): Jurnal Sains Terapan, Volume 4, Nomor 2, Tahun 2014
Publisher : IPB University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3201.498 KB) | DOI: 10.29244/jstsv.4.2.1-12

Abstract

This study aimed to evaluate the effectiveness of fresh culture product and microencapsulated Bacillus NP5 for the growth performance and immune response of common carp infected by Aeromonas hydrophilla. The 5.09 ± 0.01g common carps were reared in aquarium and fed 3 times a day for 30 days. The dose of probiotic added to feed was 1%. The treatments in this study were positive and negative control (K+ and K-; without probiotic addition), the addition of fresh culture probiotic (A), and the addition of microencapsulated probiotic (B). Each treatment was repeated in 3 replications. On day 31, the fish of K+, A, and B were injected by 0.1mL (107cfu/mL) A. Hydrophilla. While the fish of K- were injected by phosphate buffer saline (PBS). The post-infection observation was carried out for 14 days. Treatment B showed the better results which were 96% survival rate, 2.66% of daily grown rate, 1.65 of feed conversion ratio, total bacteria in the intestine and immune response which were better than control.Keywords : Bacillus NP5, fresh culture, microencapsulated, Aeromonas hydrohilla, common carp 
Co-Authors , Rahman, , , Ranta, , , Rusli, , . ARIFUDDIN . Maryani . Rahman . Sunarto A. Hasan A. Santika A. Suwanto A.J. Sihombing Ade Dwi Sasanti Aditya, Tiya Widi Afif, Usamah Afiff , Usamah Aldy Mulyadin Alimuddin Alit Brilliant Aminatul Zahra ANGELA MARIANA LUSIASTUTI Angela Mariana Lusiastuti Anis Nugrahawati Annisa Astri Anggraeni Ayi Santika Badrudin, Deni Ramdani Bambang Gunadi Benny Yustim Brite, Margie Cahyawati, Nadia Catur A. Pebrianto D. Dana D. Meha D. Wahjuningrum Daniel Djokosetiyanto DEBY YUNIASARI Dendi Hidayatullah, Dendi Dewi Rahmi DIAH AYU SATYARI UTAMI Dian Febriani Dinamella Wahjuningrum Dwi Agung Saputra E. Ayuzar E. Harris Eddy Supriyono Eka Angga Laksana Enang Harris Enang Harris Esti Handayani Hardi Evan Farhan Wahyu Puadi F.H. Pasaribu Fachriyan Hasmi Pasaribu Fadilah, Iin Nur Fadlilah, Rizqy Aditya Fitria Novianti Gustilatov, Muhamad Henky Manoppo Hisatsugu Wakabayashi I. Normalina I. Nur Iqbal Kurniawinata, Mohamad Irzal Effendi Isni Rahmatika Sari Jasmanindar, Yudiana Jeanni Indah Noermala Julie Ekasari K. Sumantadinata Khairun Nissa Komar Sumantadinata Kukuh Nirmala L. Jamal Lastriliah, Mira M. Yuhana M. Zairin Junior M.S. Arifin Mahendra, Randa Mia Setiawati Mochamad Fatuchri Sukadi Muchtar, Muthahharah Muh. Aris Muh. Fatuhcri Sukadi Muharram Nur Ikhsan Mulyani, Rahma MUNTI YUHANA Muttaqin, Helmy Faisal N.A. Maswan Nasri Julaini Nasrullah, Hasan Nur Bambang Priyo Utomo Nuzullia, Laely Odang Carman Ode, Inem P. Hadi Pras, Eva Prasetiyono Pratiwi, Kiki Amalia Putri, Shofii Amaliah R.D. Soejoedono Rafsyanzani, Muhammad Mufthi Rahman Rahman Ramadhani, Dian Eka Ramhirez, Putri Shandra Retno Damayanti Soejoedono Ririn Nurul Fauziah, Ririn Nurul Rizki Praseto, Rizki Rr. Bellya Anasti Maharani Rudi, Mad Ruku Ratu Borut Samsu Adi Rahman Sari Anggraeni, Sukma Septiani, Ghita Ryan Sri Nuryati Sri Nuryati Sugeng Budiharsono Sugiyo Hadi Pranoto Tatag Budiardi Trian Rizky Febriansyah Tsani Untsa, Agista Uba Umbara Ulil Surtia Zulpratita Umbara, Uba Wesly Pasaribu WIDANARNI WIDANARNI Wisriati Lasima Y. Tri Anggoro Yan Evan Yumaidawati, Nurfitriani Siti Yuni Puji Hastuti Zulfani, Anisa