Garuda - Garba Rujukan Digital

p-Index From 2021 - 2026

4.055

P-Index

This Author published in this journals

All Journal HAYATI Journal of Biosciences Jurnal Ilmu Pertanian Indonesia Jurnal Akuakultur Indonesia Jurnal Ilmu dan Teknologi Kelautan Tropis Jurnal Akuakultur Rawa Indonesia e-Journal BUDIDAYA PERAIRAN ILMU KELAUTAN: Indonesian Journal of Marine Sciences Jurnal Ilmu Lingkungan Jurnal Perikanan Kelautan Jurnal Natur Indonesia BIOTROPIA - The Southeast Asian Journal of Tropical Biology Jurnal Ilmu-Ilmu Perikanan dan Budidaya Perairan Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (Journal of Natural Resources and Environmental Management) OCTOPUS : Jurnal Ilmu Perikanan Omni-Akuatika Jurnal Perikanan Universitas Gadjah Mada Jurnal Intek Akuakultur Indonesian Aquaculture Journal Jurnal Riset Akuakultur Media Akuakultur Jurnal Iktiologi Indonesia (Indonesian Journal of Ichthyology) Jurnal Sains Terapan : Wahana Informasi dan Alih Teknologi Pertanian Jurnal Kedokteran Hewan Policy Brief Pertanian, Kelautan, dan Biosains Tropika Journal of Fisheries & Marine Biodiversitas Journal of Biological Diversity

Sukenda, Sukenda,

Department Of Aquaculture, Faculty Of Fisheries And Marine Science, Bogor Agricultural University, Bogor

Author-ID : 390256

Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Environmental Science Immunology & microbiology Library & Information Science Medicine & Pharmacology Social Sciences Veterinary Other

Published : 112 Documents Claim Missing Document

Claim Missing Document

Articles

1 2 3 4 5

The Chemical Composition of Gracilaria verrucosa Extract and its Utilization on Survival and Growth Litopenaeus vannamei Jasmanindar, Yudiana; Sukenda, Sukenda; Alimuddin, Alimuddin; Junior, Muhammad Zairin; Utomo, Nur Bambang Priyo
Journal Omni-Akuatika Vol 14, No 3 (2018): Omni-Akuatika November
Publisher : Fisheries and Marine Science Faculty - Jenderal Soedirman University

The Gracilaria genus is a potential source of natural and environmentally-friendly alternatives in improving the survival and growth of shrimp. This study aims to identification immunostimulant molecules extract G. verrucosa and evaluate the utilization of G verrucosa extract as an immunostimulant in improving survival and growth of L. vannamei. Seaweed extraction used ethyl acetate then formulated in the diets. The immunostimulant molecule in the G. verrucosa was analysis. The shrimp were fed a test diet containing extract G. verrucosa at a dose of 2 g kg-1 or extract G. verrucosa-free control diets for 42 days. Shrimps were fed diets containing extract with a specific duration. The observation on the survival and growth of L. vannamei was performed after maintenance at the Laboratory for six weeks. Following, diets containing extract was tested in the field (pond shrimp farm) at the same dose of extract for 58 days. Shrimp was feed diets containing extract once a week, once in the early culture, and diet control, then the survival and growth shrimp were analysis. Concentrations of sulfates and carbohydrates in G. verrucosa ethyl acetate-extract were 24.21% and 13.41%, and crude protein 3.64%. GC-MS pyrolysis results show that G. verrucosa polysaccharide is similar to immunostimulant molecules. The survival shrimp gave diets containing G. verrucosa extract formulation was higher than that of shrimps fed controls diet. The Shrimp fed diets extracts have higher growth than shrimp given control dietsKeywords: Gracilaria, extract, polysaccharides, immunostimulant

Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5â€™-CAG GCC TAA CAC ATG CAA GTC-3â€™) and reverse primer 1387r (5â€™-GGG CGG WGT GTA CAA GGC-3â€™). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60Â°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific

Toksisitas Produk Ekstrasellular (ECP) Streptococcus agalactiae pada Ikan Nila (Oreochromis niloticus) Hardi, Esti Handayani; Sukenda, Sukenda; Harris, Enang; Lusiastuti, Angela Mariana
Jurnal Natur Indonesia Vol 13, No 3 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

This research aimed to know the toxicity of extracellular products (ECP) of Streptococcus agalactiae was tastedin cultured Nile tilapia (Oreochromis niloticus). Streptococcus agalactiae had two haemolytic types: β-haemolyticand non-haemolytic type. Toxicity test of ECP to know the virulancy factor of S. agalactiae was still limited. It wasfound that after tested on 15 fish weighing 15 g through intraperitoneal injection 0,1 ml/fish, both bacteria causedchanges in swimming pattern, palatability, external and internal anatomy macroscopically and microscopically.Extracellular products of S. agalactiae non-haemolytic type (BHIA and BHI 24 h) and β-haemolytic type (BHI 72 h)caused mortality 12 hours after injection and the mortality continued till day 7 th of culture. Whirling happened 96hours after injection with ECP S. agalactiae β-haemolytic type (BHIA 72 h incubation) whereas injection with ECP(BHI 24 h) on 72 h after injection and continued untill day 7 th. Behavior disease signs caused by S. agalactiaeoccured on eyes. There were opacity, purulens, eye shrink, lateral and bilateral exopthalmia and haemorrhage oninfected-fish. Silver staining of sodium dodecyl sulphate-polyacrylamide gels to S. agalactiae revealed thatpredominant 51.8-69.6 kDa bands were present in BHIA ECP fraction. The 69.6 kDa was absent from the BHI ECP.Total protein on non-haemolytic S. agalactiae ECP are 28.18 ppm on BHIA medium and 13.64 ppm on BHI medium.Whereas β-haemolytic S. agalactiae ECP are 2.73 ppm on BHIA medium and 8.18 ppm on BHI medium. Concentrationof protein in ECP was one of factor that caused non-haemolytic S. agalactiae more virulent than β-haemolytic type.The conclusion from the research that ECP was virulent factor on β-haemolytic and non-haemolytic S. agalactiaein fish which caused changes in behavior disease signs.

Construction of a DNA Vaccine Using Glycoprotein Gene and Its Expression Towards Increasing Survival Rate of KHV-Infected Common Carp (Cyprinus carpio) Nuryati, Sri; Alimuddin, Alimuddin; Sukenda, Sukenda; Soejoedono, Retno Damayanti; Santika, Ayi; Pasaribu, Fachriyan Hasmi; Sumantadinata, Komar
Jurnal Natur Indonesia Vol 13, No 1 (2010)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Deoxyribonucleic acid (DNA) vaccine has recently been developed as an alternative vaccine against virus infection.This study was the first step of DNA vaccine development to protect cyprinids including common carp (Cyprinuscarpio) and fancy koi (Cyprinus carpio) from KHV (koi herpesvirus) infection in Indonesia. One of KHV glycoproteingenes, i.e. glycoprotein (GP) was ligated with Japanese medaka (Oryzias latipes) â-actin promoter to generatepAct/GP as a DNA vaccine. Fourty fish in body weight of 10-15 g/fish were individually injected by pAct/GP intomuscle in different dosage of 2.5 μg, 7.5 μg and 12.5 μg/100 μl phosphate buffer saline. Total RNA was extractedfrom the 12.5 μg of pAct/GP-injected fish muscle at 24, 48 and 67 hours post-injection to analyze GP expression byRT-PCR method. Potential of pAct/GP as DNA vaccine was examined by injecting KHV into the 30-days-vaccinatedfish. Both of possitive and negative control fish group were not vaccinated. Possitive control fish group wereinjected with KHV, but negative control fish group were not. KHV-challenged fish were reared for 1 month, and thedeath fish were calculated daily. Result of RT-PCR analysis showed that GP gene expression were detected at 3 dpost-injection. Expression of GP in the vaccinated fish groups helped to improve their survival rate after challengedby KHV. All of fish without DNA vaccination had dead 17 days after KHV injection. The results demonstrated thatpAct/GP had high potency to be used as a DNA vaccine against KHV infection in cyprinids.

Strategi Penerapan Ecosystem Approach To Aquaculture (EAA) Komoditas Udang di Kabupaten Pinrang Sulawesi Selatan eddy supriyono; Wisriati Lasima; Muhammad Zairin Junior; Sugeng Budiharsono; Nirmala, Kukuh; Sukenda
Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (Journal of Natural Resources and Environmental Management) Vol 11 No 3 (2021): Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (JPSL)
Publisher : Pusat Penelitian Lingkungan Hidup, IPB (PPLH-IPB) dan Program Studi Pengelolaan Sumberdaya Alam dan Lingkungan, IPB (PS. PSL, SPs. IPB)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jpsl.11.3.504-512

Penelitian ini bertujuan menyusun strategi keberlanjutan perikanan budidaya udang menggunakan pendekatan ekosistem atau EAA di Kabupaten Pinrang, Sulawesi Selatan. Serangkaian analisis dilakukan, yaitu analisis daya dukung lingkungan terhadap perikanan budidaya menggunakan standar kelayakan lingkungan tambak, analisis faktor-faktor kritis keberlanjutan perikanan budidaya menggunakan analisis Multidimensional scalling, analisis status keberlanjutan perikanan budidaya menggunakan analisis pairwise comparison dan analisis strategi pengelolaan perikanan budidaya udang berbasis pada EAA menggunakan analisis hierarchy process. Hasil penelitian menunjukkan dibutuhkan pelaksanaan strategi sebagai berikut: a) percepatan penataan ruang, dan pelaksanaan program-program yang sesuai dengan arahan pemanfaatan dan pengendalian ruang; b) penguatan kelembagaan pembudidaya permodalan guna melengkapi dan memperbaiki sarana dan prasarana sesuai dengan SOP; dan c) peningkatan taraf pendidikan dan penyediaan sistem jaminan sosial dan ekonomi bagi anggota masyarakat pembudidaya udang.

Nursery Culture Performance of Litopenaeus vannamei with Probiotics Addition and Different C/N Ratio Under Laboratory Condition . WIDANARNI; DEBY YUNIASARI; . SUKENDA; JULIE EKASARI
HAYATI Journal of Biosciences Vol. 17 No. 3 (2010): September 2010
Publisher : Bogor Agricultural University, Indonesia

Application of bioflocs technology and probiotics has improved water quality and production of Pacific white shrimp (Litopenaeus vannamei) culture. This experiment was to verify the effect of probiotic bacteria addition and different carbon:nitrogen (C:N) ratio on water quality and performance of Pacific white shrimp nursery culture. Nursery culture was carried out for 25 days in an aquarium under laboratory condition with stock density of one Post-Larvae (PL) (poslarval) per liter (24 PL/aquarium) of PL16 shrimp. Different C:N ratio resulted a significant difference on shrimp production performance. Treatment of 10 C:N ratio demonstrated the best shrimp growth (20.37 + 0.48% per day in weight and 6.05 + 0.41% per day in length), harvesting yield (1180 + 62 g/m3) and feed efficiency (121 + 6%). There was however no significant difference observed between treatments in water quality.

Bakteri Probiotik Dalam Budidaya Udang: Seleksi, Mekanisme Aksi, Karakterisasi, dan Aplikasinya Sebagai Agen Biokontrol Widanarni Widanarni; Sukenda Sukenda; Mia Setiawati
Jurnal Ilmu Pertanian Indonesia Vol. 13 No. 2 (2008): Jurnal Ilmu Pertanian Indonesia
Publisher : Institut Pertanian Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (348.509 KB)

Bacterial disease attack occurs at the hatchery stage, which is considered to be the most serious threat, and often results in mass mortality of shrimp larvae by vibrosis which is that caused by a luminous bacterium identified as Vibrio harveyi. This research was carried out to obtain local isolates of probiotic bacteria that were able to inhibit the growth of V. harveyi and effectively apply it as a biocontrol of vibriosis in shrimp cultures. The research was carried out as follows: (1) In vitro and in vivo selection of probiotic bacteria candidates, (2) Study of the action mechanism and characterization of the selected pro biotic bacteria, (3) Study on application of the selected probiotic bacteria as a biocontrol agent in shrimp cultures. Results of in vitro and in vivo selection provided the best three isolates, which were 1Ub, SKT-b and Ua. The survival rate of shrimp larvae which were not only inoculated by V. harveyi but also with 1Ub, SKT-b and Ua probiotic bacteria were 88.33, 83.33, and 81.67% respectively; where as the positive control treatment (merely inoculated with V. harveyi) gave a 41.67% survival rate and the negative control (without bacterial addition) was 68.33%. Studies using a rifampicin resistant marker (RfR) demonstrated that the number of V. harveyi MR5339 RfR cells in treatments without probiotic addition were higher than the treatment with the probiotic bacteria, in dead larvae, living larvae, as well as in the culture media. Partial sequencing of the I6S-rRNA gene showed that the I Ub isolate was similar to Pseudoalteromonas piscicida, whereas the SKT -b and Ua isolates were similar to Vibrio alginolyticus. Selected probiotic bacteria could be applied directly to shrimp larva culture media, or orally through enrichment of both natural and artificial food. Keywords: Penaeus monodon larvae, probiotic bacteria, vibriosis

Efficacy of GP-11 KHV DNA Vaccine in Common Carp (Cyprinus carpio) through Feed by Different Frequency of Administration Ahmad Beni Rouf; Sri Nuryati; Sukenda Sukenda; Alimuddin Alimuddin
Journal Omni-Akuatika Vol 16, No 1 (2020): Omni-Akuatika May
Publisher : Fisheries and Marine Science Faculty - Jenderal Soedirman University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20884/1.oa.2020.16.1.768

GP-11 KHV DNA vaccine is a vaccine that can be used to induce immunity against the KHV virus (Koi herpesvirus). Vaccination through feed is an alternative way of administering vaccines. The study aimed to examine the effect of giving KHV GP-11 DNA vaccine through feed with different frequencies to KHV infection. The frequency of vaccine administration is GP-11 vaccination once a week; GP-11(1x), GP-11 vaccination twice a week; GP-11(2x), GP-11 vaccination three times a week; GP-11(3x), GP-25 vaccinations three times a week; GP-25(3x), negative control (without KHV test) and positive control (KHV tested). The fish were kept for 28 days after vaccination and then continued with the KHV challenge test for 28 days. The weight of carp ranges from 13.82±2.37 g maintained with a density of 15 fish/aquarium. The results showed that vaccine treatment was able to induce an immune response as indicated by the number of white blood cells, lysozyme activity and post-vaccination antibody titer showed a significant effect compared to controls. Likewise, after the challenge test, supported by IFNγ and IgM gene expression parameters after the challenge test showed the highest value of vaccine treatment rather than control. The efficacy of vaccine was showed by RPS value (%) in each vaccine treatment obtained GP-11(1x) value of 44.7±3.7a, GP-11(2x) of 78.9±18.2b, GP-11(3x) 85.6±12.6b and GP-25(3x) 79.5±18.1b. It was concluded that administering the GP-11 vaccine frequency 2 times a week provides protection as strong as giving a vaccine frequency 3 times a week.Keywords: common carp, DNA vaccine, frequency of administration, koi herpesvirus

FRAKSINASI DAN UJI TOKSISITAS ECP (Extracellular Product) Streptococcus agalactiae ISOLAT NK1 PADA IKAN NILA (Oreochromis niloticus) Ibnu Bangkit Bioshina Suryadi; Sukenda .; Sri Nuryati
Jurnal Perikanan Kelautan Vol 8, No 1 (2017): Jurnal Perikanan dan Kelautan Unpad
Publisher : Fakultas Perikanan dan Ilmu Kelautan Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar

Penelitian dilaksanakan dari bulan Januari hingga September 2016 di Laboratorium Kesehatan Ikan, Fakultas Perikanan dan Ilmu Kelautan, Institut Pertanian Bogor. Penelitian ini bertujuan untuk mengetahui fraksi protein toksik dari ECP (Extracellular Product) dari bakteri Streptococcus agalactiae. 70 fraksi protein ECP S. aglactiae yang dihasilkan melalui metode kolom kromatografi, masing-masing fraksi disuntikkan secara intraperitonial pada lima ekor ikan nila dengan bobot rata-rata 20 g. Kemudian dilakukan analisis sodium dodecyl sulfate – polyacrilamid gel electrophoresis (SDS-PAGE) untuk mengetahui bobot molekul fraksi protein toksik. Parameter yang diamati adalah konsentrasi protein ECP S. agalactiae isolat NK1, gejala klinis dan mortalitas. Hasil penelitian menunjukkan bahwa terdapat delapan fraksi protein toksik dari ECP S. agalactiae isolat NK1 yaitu fraksi protein no. 6, 15, 18, 23, 28, 54 dan 70.

OCEANOGRAPHY AND WATER QUALITY CONDITION IN SEVERAL WATERS OF THOUSAND ISLANDS AND ITS SUITABILITY FOR WHITE SHRIMP Litopenaeus vannamei CULTURE Irzal Effendi; Muhammad Agus Suprayudi; I Wayan Nurjaya; Enang Harris Surawidjaja; Eddy Supriyono; Muhammad Zairin Junior; . Sukenda
Jurnal Ilmu dan Teknologi Kelautan Tropis Vol. 8 No. 1 (2016): Elektronik Jurnal Ilmu dan Teknologi Kelautan Tropis
Publisher : Department of Marine Science and Technology, Faculty of Fisheries and Marine Science, IPB University

The purposes of this study were to determine oceanographic and water quality parameters and their suitability for white shrimp Litopenaeus vannamei culture. The measurements were carried out on dry season in Semak Daun Island, Karya Island, and Panggang Island waters of Thousand Islands, with areas of 315.0, 12.0, and 102.8 ha, water depth average of 4.6 m (0.5-28.1 m), 14.6 m (0.5-26.7 m), and 5.3 m (0.8-13.6 m), mean current water velocity of 12.9, 12.7, and 13.5 cm/second, respectively. In the study areas, we found a diurnal tidal pattern with high wave in January and July-August. Based on temperature, salinity, and water density in Semak Daun Island waters, there seemingly occurred a turn over indicating a good water circulation, while in Panggang Island and Karya Island waters tended to have a stratification. Generaly, water qualities in the study areas were in the op-timum range for white shrimp culture, i.e., temperature of 29.6-30.8oC, turbidity of 0.10-1.05 NTU, transparency of 5.8-9.7 m, total suspended solid of <8 mg/L, total dissolved solid of 20-164 mg/L, pH of 6.89-7.22, salinity of 32.2-32.3, dissolved oxygen of 5.8-10.8 mg/L, ammonia of 0.068-0.145 mg/L, nitrate 1.247-2.589 mg/L, and phosphate of 1.021-2.352 mg/L. Moreover, in Semak Daun Island wa-ters, we found the highest suitability for white shrimp culture due to its better water circulation.Keywords: mariculture, coral reef waters, strait, water current, turnover, stratification.

Co-Authors , Rahman, , , Ranta, , , Rusli, , . ARIFUDDIN . Maryani . Sunarto A. Hasan A. Santika A. SUWANTO A. Suwanto A.J. Sihombing ADE DWI SASANTI Ade Dwi Sasanti Aditya, Tiya Widi Afif, Usamah Afiff , Usamah Agung Cahyo Setyawan Ahmad Beni Rouf Aldy Mulyadin Alimuddin Alimuddin Alimuddin Alit Brilliant Aminatul Zahra Amrullah Amrullah Andi Parenrengi Andi Parenrengi Andi Tenriulo Andi Tenriulo Angela M Lusiastuti Angela Mariana Lusiastuti Angela Mariana Lusiastuti Angela Mariana Lusiastuti Angela Mariana Lusiastuti Angela Mariana Lusiastuti Angela Mariana Lusiastuti ANGELA MARIANA LUSIASTUTI Angela Mariana Lusiastuti Angela Mariana Lusiastuti Angela Mariana Lusiastuti Anis Nugrahawati Annisa Astri Anggraeni Ardana Kurniaji Ayi Santika Azis Azis B. W. LAY Bambang Gunadi Bambang Gunadi Brite, Margie Cahyawati, Nadia Catur A. Pebrianto D. Dana D. Meha D. Wahjuningrum Daniel Djokosetiyanto Daniel Djokosetiyanto Daniel Djokosetiyanto DEBY YUNIASARI Dendi Hidayatullah Dendi Hidayatullah Dendi Hidayatullah Dendi Hidayatullah Dendi Hidayatullah, Dendi Desy Sugiani Desy Sugiani Dewi Rahmi DIAH AYU SATYARI UTAMI Dian Febriani Dinamella Wahjuningrum Dwi Agung Saputra E. Ayuzar E. Harris Eddy Supriyono Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Surawidjaja Enang Harris Surawidjaja Endang Susianingsih Endang Susianingsih Esti Handayani Hardi Eva Prasetiyono Eva Prasetiyono Pras F.H. Pasaribu Fachriyan Hasmi Pasaribu Fadilah, Iin Nur Fadlilah, Rizqy Aditya Fahmi Rajab Firmansyah, Arif Lukman Fitria Novianti Ghita Ryan Septiani Gustilatov, Muhamad Henky Manoppo Henky Manoppo Hisatsugu Wakabayashi Huda Salahudin Darusman Huda Shalahudin Darusman I Wayan Nurjaya I. Normalina I. Nur I. Tepu Ibnu Bangkit Bioshina Suryadi Ince Ayu Khairana Kadriah Ince Ayu Khairani Kadriah Inem Ode Iqbal Kurniawinata, Mohamad Irzal Effendi Isni Rahmatika Sari Jasmanindar, Yudiana Jean-Christophe Avarre Jeanni Indah Noermala Julie Ekasari K. Sumantadinata Khairun Nissa Komar Sumantadinata Komar Sumantadinata Komar Sumantadinata Komar Sumantadinata Kukuh Nirmala Kukuh Nirmala L. Jamal Lastriliah, Mira M. Yuhana M. Zairin Junior M.S. Arifin MIA SETIAWATI Mia Setiawati Mochamad Fatuchri Sukadi Mochamad Fatuchri Sukadi Muchtar, Muthahharah Muh. Aris Muh. Fatuhcri Sukadi MUHAMMAD AGUS SUPRAYUDI Muhammad Yamin Muhammad Zairin Jr. Muhammad Zairin Jr. Muharram Nur Ikhsan Mulyani, Rahma MUNTI YUHANA N.A. Maswan Nasri Julaini Nasrullah, Hasan Nunak Nafiqoh Nunuk Listiyowati Nur Bambang Priyo Utomo Nurbariah Nurbariah Nuzullia, Laely Odang Carman Ode, Inem P. Hadi Pratiwi, Kiki Amalia Priadi Setyawan Putri, Shofii Amaliah R.D. Soejoedono Rafsyanzani, Muhammad Mufthi Rahma Mulyani Rahman Rahman Ramadhani, Dian Eka Ramhirez, Putri Shandra Retno Damayanti Soejoedono RIDWAN AFFANDI Ririn Nurul Fauziah, Ririn Nurul Rizki Praseto, Rizki Ronald Kriston Sauttua Nainggolan Rr. Bellya Anasti Maharani Rudi, Mad Ruku Ratu Borut Samsu Adi Rahman Sari Anggraeni, Sukma Sefti Heza Dwinanti, Sefti Heza Septiani, Ghita Ryan Siti Subaidah Sri Nuryati Sri Nuryati Sugeng Budiharsono Sugiyo Hadi Pranoto Suhermanto, Achmad Tatag Budiardi Tatik Mufidah Tatik Mufidah Trian Rizky Febriansyah Tsani Untsa, Agista Tuti Sumiati Tuti Sumiati Wesly Pasaribu Wida Lesmanawati Widanarni WIDANARNI WIDANARNI WIDANARNI WIDANARNI WIDANARNI WIDANARNI Wisriati Lasima Wiyoto Wiyoto Woro Nur Endang Sariati Y. Hadiroseyani Y. Tri Anggoro Yan Evan Yosmaniar Yosmaniar Yosmaniar Yosmaniar Yumaidawati, Nurfitriani Siti Yuni Puji Hastuti Zulfani, Anisa

Title

Found 112 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 112 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 112 Documents
Search