Article Per Year (5 Year)
p-Index From 2020 - 2025
0
P-Index
This Author published in this journals
All Journal Jurnal Akuakultur Indonesia e-Journal BUDIDAYA PERAIRAN Jurnal Natur Indonesia BERITA BIOLOGI LIMNOTEK - Perairan Darat Tropis di Indonesia
Enang Harris
Department of Aquaculture
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Environmental Science

Published : 14 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 14 Documents
Search

 1   2 
PENINGKATAN KUALITAS NUTRISI TEPUNG DAUN LAMTORO SEBAGAI PAKAN IKAN DENGAN PENAMBAHAN EKSTRAK ENZIM CAIRAN RUMEN DOMBA Fitriliyani, Indira; Harris, Enang; Mokoginta, Ing; Nahrowi, Nahrowi
BERITA BIOLOGI Vol 10, No 2 (2010)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (877.781 KB) | DOI: 10.14203/beritabiologi.v10i2.1965

Abstract

The aim of this experiment is to evaluate the nutrient quality of leucaena leaf meal (LLM) with addition of sheep rumen fluid enzyme for nile tilapia feed and incubated in vitro either for 2 or 24 hours. This experiment was arranged in a completely randomized design with 6 treatments and 3 replications. Those treatments were enzyme levels of 0, 20, 40, 60, 80, and 100 ml/ kg LLM. Results showed that nutrient quality of LLM with addition of sheep rumen fluid enzyme that incubated for 24 hours had the best result compared to that incubated for 2 hours. This finding significantly affected (PO.05) on the increase of sugar release (76.97%), soluble glucose (21.27%) and soluble protein (37.7%). It is concluded that sheep rumen fluid enzyme has a great potential for improving nutritional quality of leucaena leaf meal of fish feed.
KEMAMPUAN LEMNA (LEMNA PERPUSILLA TORR.) SEBAGAI FITOREMEDIATOR UNTUK MENYERAP LIMBAH NITROGEN DALAM BUDIDAYA IKAN LELE (CLARIAS GARIEPINUS) DI SISTEM RESIRKULASI Amalia, Febrina; Nirmala, Kukuh; Harris, Enang; Widiyanto, Tri
LIMNOTEK - Perairan Darat Tropis di Indonesia Vol 21, No 2 (2014)
Publisher : Research Center for Limnology

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Penelitian ini bertujuan untuk mengkaji kemampuan lemna (Lemna perpusilla Torr.) sebagai fitoremediator dalam menyerap limbah nitrogen dalam budidaya ikan lele (Clarias gariepinus). Rancangan percobaan yang digunakan adalah rancangan acak lengkap (RAL) dengan 3 ulangan. Perlakuan berupa luas tutupan lemna sebesar 14,7%, 29,4%, dan 44,1% dari kolam filter. Padat tebar ikan lele adalah 200 ekor m-3 dengan bobot rata-rata awal 9,67±1,01 g. Hasil penelitian setelah 30 hari menunjukkan bahwa perlakuan luas tutupan lemna 44,1% dapat menyerap limbah N sebesar 4,48±0,04 g N, sedangkan untuk perlakuan luas tutupan lemna 29,4% dan 14,7% dapat menyerap limbah N masing-masing sebesar 4,03±0,02 g N dan 3,50±0,07 g N. Jumlah N dalam biomassa lemna tertinggi juga dicapai oleh perlakuan luas tutupan lemna 44,1% sebesar 28,13±0,74 g N. Sintasan tertinggi 76,33±4,04% juga diperoleh pada perlakuan luas tutupan 44,1%.
PEMANFAATAN Lemna perpusilla SEBAGAI PAKAN KOMBINASI UNTUK IKAN NILA (Oreochromis niloticus) PADA SISTEM RESIRKULASI Ilyas, Anita Prihatini; Nirmala, Kukuh; Harris, Enang; Widiyanto, Tri
LIMNOTEK - Perairan Darat Tropis di Indonesia Vol 21, No 2 (2014)
Publisher : Research Center for Limnology

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Lemna perpusilla adalah suatu makrofit yang hidup terapung di air, terdapat di seluruh dunia dan banyak ditemukan di air tawar yang kaya nutrien. Tumbuhan ini lebih dikenal sebagai gulma yang cenderung sulit untuk dikendalikan karena memiliki produktivitas yang sangat tinggi. Penelitian untuk menganalisis kemampuan ikan nila (Oreochromis niloticus) dalam memanfaatkan L. perpusilla sebagai pakan kombinasi telah dilakukan. Rancangan percobaan yang digunakan adalah rancangan acak lengkap (RAL) dengan empat taraf perlakuan dan tiga ulangan. Perlakuan konsentrasi pakan 100% L. perpusilla + 0% pelet, 25% L. perpusilla + 75% pelet, 50% L. perpusilla + 50% pelet, 0% L. perpusilla + 100% pelet. Ikan yang digunakan dalam penelitian ini adalah ikan nila (O. niloticus). Padat tebar ikan 20 individu per waring dengan bobot rata-rata 20±0,01 g per individu. Ikan diberi pakan sebanyak dua kali per hari selama 50 hari. Setiap tujuh hari sekali dilakukan penimbangan bobot tubuh ikan nila. Hasil penelitian menunjukkan bahwa L. perpusilla dapat menggantikan pelet sebagai pakan sebesar 25%. Lemna tidak dapat menggantikan pakan secara keseluruhan karena terkait dengan tingginya serat yang terkandung di dalamnya yang dapat mempersingkat waktu tubuh untuk melakukan proses pencernaan dan penyerapan nutrisi.
Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
Toksisitas Produk Ekstrasellular (ECP) Streptococcus agalactiae pada Ikan Nila (Oreochromis niloticus) Hardi, Esti Handayani; Sukenda, Sukenda; Harris, Enang; Lusiastuti, Angela Mariana
Jurnal Natur Indonesia Vol 13, No 3 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (919.679 KB) | DOI: 10.31258/jnat.13.3.187-199

Abstract

This research aimed to know the toxicity of extracellular products (ECP) of Streptococcus agalactiae was tastedin cultured Nile tilapia (Oreochromis niloticus). Streptococcus agalactiae had two haemolytic types: β-haemolyticand non-haemolytic type. Toxicity test of ECP to know the virulancy factor of S. agalactiae was still limited. It wasfound that after tested on 15 fish weighing 15 g through intraperitoneal injection 0,1 ml/fish, both bacteria causedchanges in swimming pattern, palatability, external and internal anatomy macroscopically and microscopically.Extracellular products of S. agalactiae non-haemolytic type (BHIA and BHI 24 h) and β-haemolytic type (BHI 72 h)caused mortality 12 hours after injection and the mortality continued till day 7 th of culture. Whirling happened 96hours after injection with ECP S. agalactiae β-haemolytic type (BHIA 72 h incubation) whereas injection with ECP(BHI 24 h) on 72 h after injection and continued untill day 7 th. Behavior disease signs caused by S. agalactiaeoccured on eyes. There were opacity, purulens, eye shrink, lateral and bilateral exopthalmia and haemorrhage oninfected-fish. Silver staining of sodium dodecyl sulphate-polyacrylamide gels to S. agalactiae revealed thatpredominant 51.8-69.6 kDa bands were present in BHIA ECP fraction. The 69.6 kDa was absent from the BHI ECP.Total protein on non-haemolytic S. agalactiae ECP are 28.18 ppm on BHIA medium and 13.64 ppm on BHI medium.Whereas β-haemolytic S. agalactiae ECP are 2.73 ppm on BHIA medium and 8.18 ppm on BHI medium. Concentrationof protein in ECP was one of factor that caused non-haemolytic S. agalactiae more virulent than β-haemolytic type.The conclusion from the research that ECP was virulent factor on β-haemolytic and non-haemolytic S. agalactiaein fish which caused changes in behavior disease signs.
Enhancement of non-specific immune response, resistance and growth of (Litopenaeus vannamei) by oral administration of nucleotide Manoppo, Henky; Sukenda, .; Djokosetiyanto, Daniel; Sukadi, Mochamad Fatuchri; Harris, Enang
Jurnal Akuakultur Indonesia Vol. 10 No. 1 (2011): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (207.428 KB) | DOI: 10.19027/jai.10.1-7

Abstract

This research evaluated the nonspecific immune responsse, resistance, and growth of Litopenaeus vannamei fed nucleotide diet. Shrimp juveniles (mean weight 5.39±0.56 g) were reared in two groups of glass aquaria, each with three replications. Shrimps in group one and group two were fed nucleotide diet and basal diet each for four weeks. Total haemocyte count (THC) and PO activity were evaluated at the end of feeding while growth was measured at two weeks interval. At the end of feeding trial, the shrimps were intramuscularly injected with Vibrio harveyi 0.1x106 cfu.shrimp-1. THC of shrimp fed nucleotide diet significantly increased (P
Feed efficiency improvement and aquaculture waste conversion to economically valuable product Harris, Enang
Jurnal Akuakultur Indonesia Vol. 9 No. 2 (2010): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (324.32 KB) | DOI: 10.19027/jai.9.196-205

Abstract

Fish farmer cannot reduce feed price, however they can reduce feed cost for fish producing. Feed cost is highly determined by feeding rate (FR); whether in maximum FR or restricted FR, and dissolved oxygen level in water. The present paper reviews a detail explanation concerning both factors on feed efficiency. Amongst other water quality parameters, oxygen is the most important factor and therefore must be closely monitored. Moreover, dissolved oxygen cannot be detected only by visual observation. Biofloc technology and PAS (partitioned aquaculture system) can change waste into bacteria and phytoplankton biomass which can be further utilized as fish feed. The major difference between these systems is in the oxygen requirement. This paper also presents some experiment results and preliminary applications in field scale that have been performed in Indonesia.Keywords: feeding rate, oxygen, feed efficiency. ABSTRAKPembudidaya ikan tidak bisa menurunkan harga pakan, tetapi dapat menurunkan biaya pakan untuk memproduksi ikan. Biaya pakan sangat ditentukan oleh feeding rate (FR); apakah ”maksimum FR” atau ”restricted FR”, dan oksigen terlarut dalam air. Dalam artikel ini diuraikan secara rinci mengenai pengaruh kedua faktor tersebut terhadap efisiensi pakan. Oksigen merupakan faktor yang paling penting di antara kualitas air, oleh karena itu kadar oksigen terlarut harus diukur. Oksigen terlarut tidak dapat dideteksi dengan panca indera manusia. Teknologi biofloc dan PAS (partitioned aquaculture system) mampu mengubah limbah jadi bakteri dan fitoplankton yang siap untuk menjadi makanan ikan. Perbedaannya antara kedua sistem terletak pada kebutuhan oksigen. Artikel ini juga memuat hasil percobaan dan praktik rintisan skala lapangan yang telah dilaksanakan di Indonesia.Kata kunci: feeding rate, oksigen, efisiensi pakan.
Isolation and characterization of pathogenic Vibrio on tiger grouper Epinephelus fuscoguttatus Ilmiah, .; Sukenda, .; Widanarni, .; Harris, Enang
Jurnal Akuakultur Indonesia Vol. 11 No. 1 (2012): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1133.598 KB) | DOI: 10.19027/jai.11.28-37

Abstract

This study was aimed to obtain pathogenic bacterial isolate causing vibriosis disease. Isolation of Vibrio was conducted from maribound tiger grouper collected from floating net cage in Barru Regency using TCBS medium. Ability to cause vibriosis was confirmed by pathogenicity test performed by mean injecting the tiger grouper juveniles with bacterial suspension at concentration of 106 CFU/fish and mortality of fish during seven days observation then was noted. Then, the Vibrio pathogenic isolate was characterized and identified based on morphology, growth, and biochemical features. Moreover, the most pathogenic isolate was identified by molecular analysis of 16S-rRNA gene sequences. The results showed that three potential isolates caused Vibriosis disease in tiger grouper culture. The isolates tested were biochemically identified as Vibrio metschnikovii, V. parahaemolyticus, and V. mimicus. The most virulent among isolates was V. parahaemolyticus. Keywords: isolation, characterization, pathogenic, vibriosis, tiger grouper
Selection of probiotic bacteria from the coral reef and tiger grouper fish (Epinephelus foscoguttatus) farming environment Ilmiah, .; Sukenda, .; Widanarni, .; Harris, Enang
Jurnal Akuakultur Indonesia Vol. 11 No. 2 (2012): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1171.137 KB) | DOI: 10.19027/jai.11.109-117

Abstract

The use of probiotic bacteria is one of the methods in aquaculture to control infectious diseases. This study aims to obtain candidates probiotic bacteria from the coral reef and tiger grouper aquaculture environment (Epinephelus fuscoguttatus). Steps of the study included of: 1) isolation of candidates probiotic bacteria, 2) selection of candidates probiotic bacteria: inhibition test and co-culture methods, 3) enzymatic test, 4) the growth of bacteria test 5) pathogenicity test and 6) the molecular identification of probiotic bacteria. The results showed that of 124 isolates in test zone of inhibition, the four isolates with the widest zone of inhibition of isolate K7, K8, K21, and T4, a total of 51 isolates on co-culture methods, the four isolates were able to suppress the growth of pathogenic Vibrio bacteria, isolates K15, K68, K55, and T36. The results of hydrolyzing the highest protease amylase and lipase enzyme, respectively isolates K15 and T36; isolates T41 and K8; isolates K55 and K68. Candidates probiotic bacteria reached the exponential phase at 16‒18 h. The results of pathogenicity test isolate K7, K8, T36, and T41 provided the highest survival that can be used as candidates probiotics in the tiger grouper. Keywords: selection, probiotics, tiger grouper
The use of sand as a substrate for culture of polychaeta worm Dendronereis pinnaticirris Mustofa, Ahmad Ghufron; Harris, Enang; Supriyono, Eddy; Jusadi, Dedi
Jurnal Akuakultur Indonesia Vol. 11 No. 2 (2012): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (837.953 KB) | DOI: 10.19027/jai.11.118-123

Abstract

This experiment was conducted to study the activity, protein retention, daily growth rate, and production of Dendronereis pinnaticirris cultured in different soil substrates. Forty tested worms with average body weight of 150 mg were adapted in laboratory for 30 days. Thereafter, worms were cultured for 30 days in the 13.6 L aquaria and equipped with aeration system. A triplicate experiment was conducted using 10 cm depth of sterilized soil substrate with particle diameter of either 63‒250 μm, 250‒500 μm, or without substrate. The results showed that (1) D. pinnaticirris always swims actively when cultured in the medium without substrate, thereby resulting into the mass mortality (96.7%); (2) the substrate with particle diameter of 63‒250 μm generated significantly higher daily growth rate, survival rate, and production of D. pinnaticirris, but protein retention and feed efficiency were insignificance with those cultured in the substrate of 250–500 μm.Keywords: substrate, protein retention, production, Dendronereis pinnaticirris
Co-Authors A.A. Ketut Agung Cahyawan W Ahmad Ghufron Mustofa Alexander Burhani Marda, Alexander Burhani ANGELA MARIANA LUSIASTUTI Bambang Gunadi Daniel Djokosetiyanto DEDI JUSADI Eddy Supriyono Esti Handayani Hardi Febrina Amalia Henky Manoppo Iis Diatin Ilyas, Anita Prihatini Indira Fitriliyani Ing Mokoginta Kukuh Nirmala Mochamad Fatuchri Sukadi Muh. Aris Muh. Fatuhcri Sukadi MUHAMMAD AGUS SUPRAYUDI RIDWAN AFFANDI Robin, , Sukenda . Tatag Budiardi Tri Widiyanto WIDANARNI WIDANARNI