cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Kuntaman
Contact Email
jcmidpamki@gmail.com
Phone
+6281337051550
Journal Mail Official
jcmidpamki@gmail.com
Editorial Address
Departemen Mikrobiologi, Fakultas Kedoteran Universitas Airlangga, Jl. Prof. Dr. Moestopo 47 Surabaya 60286
Location
Kota surabaya,
Jawa timur
INDONESIA
Journal of Clinical Microbiology and Infectious Diseases
Published by Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia
ISSN : -     EISSN : 28089405     DOI : https://doi.org/10.51559/jcmid
Core Subject : Science,
Immunology & microbiology
Journal of Clinical Microbiology and Infectious Diseases; peer-reviewed journal aiming to communicate high-quality research articles, reviews, and general articles in the field. JCMID publishes articles that encompass basic research/clinical studies related to microbiology and infectious disease. The Journal aims to bridge and integrate the intellectual, methodological, and substantive diversity of medical scholarship and encourage a vigorous dialogue between medical scholars and practitioners.
Arjuna Subject : Kedokteran - Mikrobiologi (Medis)
Articles 5 Documents
 1 
Search results for , issue "Vol. 2 No. 1 (2022): Availabel Online: June 2022" : 5 Documents clear
An unusual Lecythophora fungal keratitis case report: - Qonita Imma Irfani; R Ludhang Pradipta Rizki; Suhardjo
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.11

Abstract

Introduction: The infective process of the cornea caused by any number of pathological fungi that can invade the ocular surface is referred to as fungal keratitis or Keratomycosis. Fungal keratitis is a major vision-impairing condition worldwide as it is so difficult to treat. In order to prevent or reduce severe complications following an infection, microbiological culture and direct microscopic examination are critical to be done. Thus, early diagnosis and prompt treatment can be established. In this report, we want to explain a rare case of Lecythophora spp. fungal keratitis on women with ocular trauma caused by the rope’s end.Case Description: A 62-year-old woman presented to the hospital with complaints of watery eyes, redness, corneal ulcer, and a sensation of something in the eye in her left eye for 12 days with progressive vision loss. A history of left eye trauma was found. The patient had left ocular trauma from the rope end. There were no other symptoms that suggested an underlying disease. On microbial examination, we observed a Lecythophora spp. The colony was flat, smooth, moist to slimy, pink to violet on the surface, and tan on the reverse. Antifungal susceptibility tests revealed the species was still tolerant to Terbinafine, while resistance to Ketoconazole, Fluconazole, and Itraconazole was detected. Because Terbinafine was unavailable, the patient was still receiving ketoconazole, fluconazole, and natamycin therapy. Therefore no significant improvement was achieved. The patient continued to require corneal ulcer debridement twice a day to gain further improvement.Conclusion: Fungal Keratitis or Keratomycos is an invasive infection caused by a variety of Fungi, and sometimes it can be happened by the history of Corneal trauma and make a progressive decrease in vision.
Streptococcus agalactiae is resistant to β-lactam antibiotics in a diabetic patient with foot infection: a case report Yolanda Pitra Kusumadewi; Afdina Melya Ganes Febiyanti; Ilma Tazkiya; Galang Ridha Allatief; Annisa Somaningtyas; Cicilia Widhi Astuti; Ika Puspitasari; Kuwat Triyana; Tri Wibawa; Titik Nuryastuti
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.13

Abstract

Introduction: Diabetic foot infection is a complication that often occurs in people with diabetes mellitus. Staphylococcus aureus is the most common microorganism found in diabetic foot infections. In addition, coagulase-negative staphylococci, Enterococcus faecalis, Streptococcus agalactiae, and Pseudomonas aeruginosa can also be demonstrated. Diabetic foot infection treatment usually takes a long time which may increasing the risk of antibiotic resistance. This article will present a unique and interesting case about Streptococcus agalactiae resistant to β-lactam infection. Case description: A 56-year-old man presented with a long history of diabetes mellitus but had not taken anti-diabetic drugs and had no history of previous use of antibiotics. Since 2016 his right foot had a recurring wound that he routinely treated. Microbiology culture of the wound swab obtained three bacteria namely Streptococcus agalactiae, Proteus mirabilis and Klebsiella pneumoniae which is resistant to β-lactam antibiotics. Conclusion: The identification of Group B Streptococcus bacteria (Streptococcus agalactiae) which are resistant to β-lactam antibiotics (penicillin, third and fourth generation cephalosporins) which were found in this case, reminds all medical personnel to be more careful and prudent in the rational use of antibiotics.
The The circulation of sars-cov-2 virus inward environment of covid-19 intensive care unit, Dr. Soetomo Hospital Surabaya Eko B. Koendhori; L. Alimsardjono; S. R. S. Oktaviani; A. M. Widya; Deby Kusumaningrum; Naritha; N. D. Kurniati; P. N. Endraputra; K. Kuntaman
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.15

Abstract

Introduction: The big problem to overcome COVID-19 transmission is to suppress the viral particle circulation in the air and environment. A severe case of COVID-19 is commonly managed in a negative pressure ICU ward. Covid-ICU room in Dr. Soetomo hospital is a negative pressurized room comprising 5 rooms with an occupancy of 2 beds per room. Meanwhile, the patient’s environment is still possibly contaminated by the virus due to airborne transmission of the virus having tiny particles so the virus can easily spread through the patient’s environment. Thus, the purpose of this study is to evaluate the presentation of the SARS-CoV-2 virus, that was contaminating the room air, floor, and other surfaces inside the Covid-ICU. Method: The study was a cross-sectional descriptive study. The biological sample that analyzes was air. The air samples were taken from all areas including ante-room, patient room, gallery, clothing room, nurse station, and ICU area outside the room using an air sampler (As82 PURIVA H1) with a capacity of 200 m2/hour. The virus filter was put in the port of air entry, after air suction for 2 hours, it was immersed in VTM and continued for rtRT-PCR (real-time Reverse Transcriptase PCR) examination. Surfaces samples were taken by swabbing on the floor, bed cover, door handle, medical equipment, wall, and other equipment. They were swabbed for 5 specimens per location. After data was collected, it analyzes descriptively by using SPSS ver.25 Results: A total of 39 air samples were collected and examined with an RT-PCR machine, 5 (12.8%) positive namely 2 samples from the gallery and 3 from one room, whereas from 30 surfaces, 1 (3.3%) positive, from a sample of the bed cover. Conclusion: The SARS-CoV-2 virus is identified in the air and surface of Covid-ICU wards, indicating the risk for Covid-19 transmission. It is important for Infection Prevention and Control (IPC) policy implementation in a clinical setting.
Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates Titiek sulistyowati; Soedarsono; Ni Made Mertaniasih
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.18

Abstract

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.
The effectiveness of patchouli oil as hand sanitizer: a comparative study between two antiseptic brands Zinatul Hayati; Dedy Syahrizal; Nisrina Nurhikmah; Fauzul Husna; Wilda Mahdani; Ade Oktiviyari; Tjut Mariam Zanaria
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.21

Abstract

Introduction: Hand hygiene is a non-pharmacological intervention recommended worldwide to prevent and control infectious diseases. Hand sanitizer is an antiseptic that contains active agents and could eradicate pathogenic microorganisms caused by infectious diseases. The addition of patchouli oil as an active agent in hand sanitizers has been proven to have a bactericidal and bacteriostatic effect against bacteria and viruses. This study aims to compare Hand sanitizer A's effectiveness (which does not contain patchouli oil) with Hand sanitizer B (containing patchouli oil) by comparing the number of normal hand flora colonies before and after using both hand sanitizers. Methods: This study is a pre-experimental design with a static group pretest and posttest design. There were 16 Medical Laboratory Technologists (MLT) enrolled in the study. Each MLT received two interventions, using Hand sanitizer A and B. The hand swabs were collected before and after using both hand sanitizers. The swabs inoculated on the media, incubated, and colony-forming units were counted. Result: This study showed a significant difference between hand sanitizers containing and not containing patchouli oil in reducing the number of normal hand flora colonies with a p-value = 0.033 (α < 0.05). The median value of total colonies decreased in Hand sanitizer B is 15, lower than the median value of Hand sanitizer A, which is 36. Conclusion: Hand sanitizer B containing patchouli oil possessed preferable effects to Hand sanitizer A, which does not contain patchouli oil in reducing the number of normal hand flora colonies.

Page 1 of 1 | Total Record : 5

 1 

Filter by Year

2022 2022


Reset
Filter By Issues
All Issue Vol. 5 No. 1 (2025): Available online : 1 June 2025 Vol. 4 No. 2 (2024): Available online : 1 December 2024 Vol. 4 No. 1 (2024): Available online: June 2024 Vol. 3 No. 2 (2023): Available online: December 2023 Vol. 3 No. 1 (2023): Available online : June 2023 Vol. 2 No. 2 (2022): Available Online: December 2022 Vol. 2 No. 1 (2022): Availabel Online: June 2022 Vol. 1 No. 2 (2021): Available Online: December 2021 Vol. 1 No. 1 (2021): Available Online: June 2021