cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 5 Documents
Search results for , issue " Vol 10, No 1 (2005)" : 5 Documents clear
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus Susetya, Heru; Naoto, Ito; Sugiyama, Makoto; Minamoto, Nobuyuki
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.632 KB)

Abstract

The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesiawas determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of theRC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomainbetween this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effectivefor rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the Ggenes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus fromChina than to viruses from Thailand and Malaysia. This genetic data and historical background suggest thatrabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from Chinato Indonesia.Keywords : Rabies virus, Glycoprotein gene, Ectodomain, Phylogenetic analysis
A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis S, Sumartono
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.325 KB)

Abstract

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecularprobe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genomeand a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probelabeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with themolecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detectionstarter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequenceGGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNAtarget by dot blot method.Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization
Cloning Gene Encoding Micronema 3 (Mic3) Protein of Tachyzoite Toxoplasma Gondii Local Isolate Artama1, Wayan T.; Dewi, Ni Nyoman Ayu; Subekti, Didik Tulus
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (308.784 KB)

Abstract

Microneme 3 (MIC3) protein tachyzoites Toxoplasma gondii is one of protein which plays an important roleduring cell host invasion. Gene encoding MIC3 protein has been studied and it was suggested a potent vaccinecandidate against Toxoplasma gondii infection. The aim of this research is to clone and sequence the gene encodingMIC3 protein of tachyzoites Toxoplasma gondii local isolate by amplification using polymerase chain reaction withspecific primers. The amplified DNA fragment was cloned into pGEM-T and transformed into E. coli XL-1 Blue byheat shock method. Recombinant plasmids were isolated using alkali lysis method and analyzed by digestionusing restriction endonuclease enzymes PstI, HindIII, NcoI and EcoRV. The recombinant plasmids then sequencedto find out the nucleotide sequence of insert gene by ABIPRISM 377 DNA Sequencer. The DNA sequence thenwere analyzed by computer software for alignment. The result showed that transformation in E. coli XL-1 Blue bypGEM-T produced one clone that was encoding MIC3 protein. Analysis of 489 bp from 5’ and 447 from 3’ of genesequence showed 97-98% homology with gene encoding for MIC3 protein of RH isolate.Keywords: MIC3 protein, Toxoplasma gondii, tachyzoite, recombinant DNA
Cloning of cDNA Encoding GRA1 Protein of Tachyzoite Toxoplasma Gondii Local Isolate Sulistyaningsih, Erma; Moeljopawiro, Sukarti; Subandono, Jarot; Artama, Wayan T.
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (196.441 KB)

Abstract

Gene encoding GRA1 protein is potent DNA-vaccine candidate against toxoplasmosis. The aim of the researchwas to clone the gene encoding GRA1 protein of tachyzoite Toxoplasma gondii local isolate by DNA recombinanttechnology. Tachyzoite was grown in Balb/c mice in vivo. Messenger RNA was isolated from total RNA and itwas used to synthesis cDNA. Complementary DNA encoding GRA1 protein of tachyzoite Toxoplasma gondii localisolate was amplified and cloned in a prokaryote cloning vector. The recombinant GRA1-encoding gene was thendigesting using EcoRI restriction endonuclease and sequencing. The result showed that the recombinant GRA1-encoding gene consisted of DNA sequences encoding all signal peptide and mature peptide of GRA1 protein.Alignment of recombinant GRA1 sequence to gene encoding GRA1 protein of Toxoplasma gondii RH isolate showed100% homologous.Keywords: GRA1 protein, Toxoplasma gondii, tachyzoite, cloning, cDNA
Expression Analysis and Nuclear Import Study of Full-length Isoforms Importin α as 6x Histidin-tagged Fusion Protein on the Intracellular Localization of Recombinant HBV Core Protein Haryanto, Aris
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (506.698 KB)

Abstract

Isoform importin α molecules play a central role in the classical nuclear import pathway, that occurs throughthe nuclear pore complex (NPC) and typically requires a specific nuclear localization signal (NLS). In this study,it was investigated the role of isoforms importin α in the nuclear import of wild type recombinant hepatitis B viruscore protein (WT rHBc), phosphorylated recombinant HBV core (rHBc) and recombinant HBV core without NLSby co-immunoprecipitation. Four recombinant full-length isoforms importin α as 6x histidin-tagged fusion proteinwere expressed and analysed from expression plasmid vectors Rch1, pHM 1969, pHM 1967 and pHM 1965. Theresults indicated that importin α-1, importin α-3, importin α-4 and importin α-5 can be expressed and isolatedfrom E. coli transformed recombinant DNA plasmid as protein in size around 58-60 kDa. By the nuclear transportstudy shown that isoforms importin α are involved in the nuclear import of WT rHBc, phosphorylated rHBc andrHBc without NLS. It also indicated that they have an important role for nuclear transport of from cytoplasm intothe nucleus.Keywords: NPC, NLS, importin α, importin β, isoforms importin α as 6x histidin-tagged fusion protein, WTrHBc, SV40 Tag, co-immunoprecipitation, westernblotting.

Page 1 of 1 | Total Record : 5


Filter by Year

2005 2005