cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota denpasar,
Bali
INDONESIA
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry)
Published by Universitas Udayana
ISSN : -     EISSN : 23027274     DOI : -
Core Subject : Science, Engineering,
Chemical Engineering, Chemistry & Bioengineering Chemistry Electrical & Electronics Engineering
Jurnal ini merupakan jurnal elektronik di bidang kimia terapan yang dikelola oleh Magister Kimia Terapan, Program Pascasarjana, Universitas Udayana, Bali. Jurnal ini memuat artikel-artikel penelitian yang berhubungan dengan Kimia Terapan yang meliputi Kimia Analitik, Kimia Polimer, Biokimia, Kimia Bahan Alam, Kimia Fisik, Kimia Permukaan, Biomaterial,dan bidang-bidang terkait. Jurnal ini akan terbit 2 kali dalam setahun yaitu pada bulan Pebruari dan September. Jurnal ini terbuka untuk diakses oleh semua kalangann(Open Access Journal)
Arjuna Subject : -
Articles 7 Documents
 1 
Search results for , issue "Vol 3 No 3 (2015)" : 7 Documents clear
DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB) DENGAN METODE POLYMERASE CHAIN REACTION Luk Ketut Budi Maitriani; I Nengah Wirajana; Sagung Chandra Yowani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (230.013 KB)

Abstract

ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen). Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB) mencakup kodon 94 (nukleotida 280-282). Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077). Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR). Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit) serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen), meliputi: panjang primer, %GC, Tm (melting temperature), interaksi primer (dimers dan hairpins), stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA) 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.  ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen). The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB) clinical isolates include codon 94 (nucleotide 280-282). Codon 94 of inhA gene is frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077). Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes) with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen) such as: primer length, %GC, Tm (melting temperature), primers interaction (dimers and hairpins), stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA) 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS) at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.  
ISOLASI DNA METAGENOMIK DARI SPUTUM PASIEN TUBERKULOSIS DAN AMPLIFIKASI DENGAN PRIMER PROMOTER inhA Ni Made Yustikarini; Sagung Chandra Yowani; I Nengah Wirajana
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (220.918 KB)

Abstract

 ABSTRAK: Penelitian ini bertujuan untuk memperoleh DNA metagenomik dari sputum pasien tuberkulosis dan mengamplifikasi dengan menggunakan primer promoter inhA. Penelitian ini dilakukan dalam tiga tahap, yaitu: isolasi DNA metagenomik dari sputum pasien tuberkulosis, amplifikasi menggunakan sepasang primer promoter inhA dari M. tuberculosis dengan metode PCR, dan elektroforesis gel agarosa terhadap hasil amplifikasi. Elektroforegram hasil amplifikasi menunjukkan bahwa isolasi DNA metagenomik dari sputum pasien tuberkulosis telah berhasil dilakukan dengan metode modifikasi maupun dengan kit. Ukuran pita fragmen DNA sekitar 284 bp dari hasil amplifikasi (amplikon) yang diperoleh dari DNA metagenomik sputum P.48B, P.46B, dan P.47B  MDR- TB  merupakan ukuran yang sesuai dengan bagaian dari daerah promoter inhA M. tuberculosis. Ukuran amplikon ini sama dengan ukuran amplikon yang sebelumnya telah diperoleh dari amplifikasi terhadap DNA M. tuberculosis oleh peneliti sebelumnya dengan menggunakan primer yang sama.ABSTRACT: The aims of this research were to obtain metagenomic DNA from sputum of tuberculosis patients and to amplify it by using inhA promoter primer. This research was conducted in three steps covering the DNA metagenomic isolation from sputum of tuberculosis patients, amplification of inhA promoter region of M. tuberculosis by using specific primer pair by PCR (Polymerase Chain Reaction) method, and electrophoresis of amplified products using agarose gel. The electrophoregram of amplified products showed that the metagenomic DNA isolation from sputum of tuberculosis patients was successfully carried out both by the modified method and by a kit. The size of DNA fragment bands about 284 bp of amplified products (amplicons) which obtained from the metagenomic DNAs of P.48B, P.46B, P.47B sputum was suitable size with a part of inhA promoter region of M. tuberculosis. The size of these amplicons was the same size with the amplicons from M. tuberculosis DNA reported by other researchers.
DAYA BUNUH EKSTRAK DAUN SRIKAYA (A. squamosa L.) TERHADAP TELUR DAN LARVA A. aegypti Nur Vita Purwaningsih; Made Pasek Kardiwinata; Ni Wayan Arya Utami
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (163.446 KB)

Abstract

ABSTRAK: Nyamuk A. aegypti merupakan vektor utama DBD. Upaya memberantas nyamuk dewasa dengan fogging merupakan upaya terakhir, tetapi tanpa pemberitahuan ke masyarakat sehingga masyarakat tidak mengetahui atau belum siap. Usaha lain adalah menabur abate tetapi air yang ditaburi abate menjadi berbau kurang sedap, dan bersifat karsinogenik. Oleh karena itu, diperlukan insektisida alternatif yang alami dan bersifat mudah terurai di alam. Penelitian ini bertujuan untuk mengetahui daya bunuh ekstrak daun srikaya  terhadap telur dan larva A. aegypti. Penelitian ini menggunakan rancangan eksperimental dengan menggunakan metode post test only control group design. Sampel penelitian adalah 576 butir telur A. aegypti dan 576 ekor larva A. aegypti masing-masing dari Instar I, II, III dan IV, jumlah dalam satu wadah 24 ekor dengan 4 kali pengulangan dengan menggunakan konsentrasi 50 ppm, 100 ppm, 200 ppm, 300 ppm dan 400 ppm. Hasil penelitian didapatkan kematian telur dengan LC50 sebesar 42,5423 ppm dan LC90 52,0052 ppm, larva instar I didapatkan LC50 sebesar 36,9248 ppm dan LC90 45,1515 ppm, larva instar II didapatkan LC50 sebesar 49,5588 ppm dan LC90 60,3818 ppm, larva instar III didapatkan LC50 sebesar 90,2210 ppm dan LC90 141,021 ppm, larva instar IV didapatkan LC50 sebesar 98,6166 ppm dan LC90 156,402 ppm. Hasil uji Mann-Whitney diperoleh p<0,05 yang menunjukkan terdapat perbedaan konsentrasi yang bermakna dalam menyebabkan kematian telur dan larva. Dari hasil penelitian dapat disimpulkan bahwa ekstrak daun srikaya memiliki daya bunuh terhadap telur dan larva A. aegypti.   ABSTRACT: Haemorrhagic Dengue Fever (HDF) is transmitted through mosquito A. aegypti is the primary vector. Fogging is the last attempt to eradicate A. aegypti, the prevention of the fogging could kill adult mosquitoes, the implementation of fogging sometimes not notice the announcement, so the society does’nt know about it or not ready yet. Besides fogging, spreading abate is another effort that often have been done, the water that have been spread by abate smell bad and caused carcinogenic. Therefore it needs natural alternative insecticides and also easy to biodegradable in the nature. The aim of this study is determine the ability of sugar apple leaf extract to kill the eggs and larvae of A. aegypti. This study used an experimental design by using post test only control group design. The sample was 576 eggs of A. aegypti and A. aegypti larvae 576 each from instar I, II, III and IV, the amount in the container 24 tail with four repetitions by using a concentration of 50 ppm, 100 ppm, 200 ppm, 300 ppm and 400 ppm. The result showed the egg mortality is 42.5423 ppm with LC50 and 52,0052 ppm with LC90, In the first instar larvae obtained by 36.9248 ppm with LC50 and 45,1515 ppm with LC90, second instar larvae obtained by 49.5588 ppm with LC50 and 60,3818 ppm with LC90, third instar larvae obtained by 90.2210 ppm with LC50 and 141,021ppm with LC90, fourth instar larvae obtained by 98,6166 ppm with LC50 and 156,402 ppm with LC90. Mann-Whitney test results obtained p <0.05 which shows there is a difference in the concentration causing the death of eggs and larvae. From the result of research we can conclude that the leaf extract of sugar apple has the ability to kill the eggs and larvae of A. aegypti.
VARIASI KONSENTRASI BUAH ASAM (Tamarindus indica L.) DAN SUSU SKIM TERHADAP KUALITAS YOGHURT KUNIR ASAM Ni Putu Rahayu Artini; Ida Bagus Putra Manuaba; I Nengah Wirajana
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (242.519 KB)

Abstract

ABSTRAK: Penelitian ini bertujuan untuk mengetahui pengaruh variasi konsentrasi buah asam (Tamarindus indica L.) dan  susu skim untuk menghasilkan kualitas yoghurt sesuai  dengan SNI 01-2981-2009.Rancangan percobaan yang dilakukan dalam penelitian ini adalah Rancangan Acak Lengkap (RAL) yang terdiri atas sembilan perlakuan. Yoghurt kunir asam dibuat dari variasi penambahan variasi konsentrasi Tamarindus indica L. 30%, 40%, dan 50% (b/V) dan  susu skim 5%, 10%, dan 15% (b/V). Sifat fisika, kimia, dan mikrobiologi  yoghurt kunir asam diamati. Dihasilkan kualitas terbaik yoghurt kunir asam dengan penambahan 30% Tamarindus indica L. (b/V0dan 15% susu skim (b/V). Dengan hasil analisis penampakan cairan kental; konsistensi homogen; rasa asam; bau khas; viskositas 89,3 cP; pH 4,85; kadar abu 1,52%; kadar lemak total 2,53%; kadar protein total 3,74%; kadar asam laktat 0,223%, kadar kurkumin 0,389%; cemaran logam Pb dan Cu serta Total Coliform dan E. coli negatif.ABSTRACT:.The objective of this research was to determinethe influence of concentrated Tamarindus indica L. and skim milk powder in producing tumuric curcumin yogurt towards its product based on SNI 01-2981-2009. The research was conducted in completely randomized design which consisted of nine treatments. The yogurt mixtures were made from a variation of 30%, 40%, and 50% of Tamarindus indica L. and addition of  5%, 10%, and 15% of skim milk powder.  Physical, chemical, and microbiology properties of the turmeric curcuma yogurts were observed.  The results showed the best quality of turmeric curcumin  yogurt was formulated by the addition of 30% Tamarindus indica L. and 15% skim milk powder,  with the results of the analysis: the appearance of a viscous fluid; homogeneous consistency; sour taste; distinctive smell; viscosity of 89.3 cP; pH of 4.85; ash content of 1.52%; total fat content of 2.53%; total protein content of 3.74%; lactic acid levels of 0.22%, curcumin content of 0,389%; however the Pb, Cu, Coliform and E. coli were not detected.
ANALISIS POTENSI PROTEASE EKTRASELULER TANAH HUTAN MANGROVE PANTAI SUWUNG KAUH BALI Inten Hardianti Nizar; I Nengah Wirajana; A.A.I.A Mayun Laksmiwati
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (177.147 KB)

Abstract

ABSTRAK: Potensi tanah hutan mangrove pantai Suwung Kauh Bali sebagai sumber protease dapat diketahui dengan melakukan uji aktivitas protease ekstraseluler. Pada penelitian ini telah dilakukan pengukuran aktivitas protease ekstraseluler dan penentuan pengaruh waktu inkubasi serta penambahan toluena terhadap aktivitas protease. Sampel yang digunakan sebagai sumber enzim berupa slurry dan direaksikan dengan substrat kasein 0,3% selama 3,6,9 dan 24 jam dengan dan tanpa penambahan toluena 1% (v/v). Produk reaksi enzimatis diukur dengan metode kolorimetri. Aktivitas protease tertinggi yang diperoleh sebesar 1,9 x 10-4 U/mL dengan penambahan toluena pada waktu inkubasi 6 jam dan sebesar 1,2 x 10-4 U/mL tanpa penambahan toluena pada waktu inkubasi 9 jam. Hasil ini menunjukkan bahwa protease ekstraseluler pada tanah hutan mangrove yang dihasilkan oleh mikroba proteolitik memilki potensi digunakan untuk eksplorasi enzim. Waktu inkubasi dan penambahan toluena tidak berpengaruh signifikan terhadap aktivitas protease.   ABSTRACT: The potency of mangrove soil in Suwung Kauh Bali as a source of protease has been determined by protease activity assay. This research has been done to determine protease activity and the effect of incubation time and the addition of toluene to the protease activity. The slurry of soil was used as a source of extracellular  enzyme for protease assay, which was reacted with casein 0,3% for 3, 6, 9, and 24 hours with and without the addition of toluene 1% (v/v). The enzymatic reaction product was measured by colorimetric method. The highest protease activity with addition of toluene was 1,9 x 10-4 U/mL at 6 hours incubation and without toluene was 1,2 x 10-4 U/mL at 9 hours incubation. These results showed extracelluler protease on mangrove soil produced by proteolytic microorganisms had a potency to be used in enzyme exploration. Furthermore, the incubation time and addition of toluene had no significant effect to protease activity.
KARAKTERISASI BIODIESEL DARI MINYAK JELANTAH MENGGUNAKAN PEREAKSI BIOETANOL TETES TEBU Sagung Ngurah Mayuni; Ni Made Suaniti; Ida Bagus Putra Manuaba
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (366.727 KB)

Abstract

ABSTRAK: Biodiesel merupakan bahan bakar alternatif yang dapat disintesis dari minyak jelantah dan alkohol melalui proses esterifikasi. Penelitian ini menggunakan bahan dasar minyak jelantah dengan kadar asam lemak bebas sebesar 9,16 %, dimana alkohol yang digunakan adalah bioetanol tetes tebu. Tujuan penelitian ini adalah untuk mengkarakterisasi biodiesel hasil esterifikasi dan transesterifikasi minyak jelantah dengan hasil destilasi bioetanol tetes tebu. Metode penelitian yang dilakukan adalah menggunakan perbandingan bervariasi antara minyak jelantah dan etanol yaitu 1 : 1 (B1), 3:1 (B2), 5:1 (B3). Hasil karakterisasi biodiesel diperoleh sesuai dengan SNI berturut-turut untuk densitas B1 = 860,3, B2 = 865,3 , B3 = 866,3 (kg/m3), Viskositas B1 = 19,138 , B2 = 24,881 , B3 = 25,359(mm2/s), Titik NyalaB1 = 138,5, B2 = 93,5, B3 = 212,5 (0C). Titik tuang B1 = 6, B2 = 93,5, B3 = 212,5. Titik Tuang B1 = 6, B2 = 6, dan B3 = 9 (0C). Korosi B1 = 1a, B2 = 1a dan B3 =1a. Untuk kadar air dengan hasil B1 = 0,05, B2 = trace (tidak terdeteksi) dan B3 = 0,2 (% v/v).Biodiesel minyak jelantah dan etanol tetes tebu dapat terbentuk, setelah dianalisis dengan kromatografi gas menunjukkan adanya senyawa ester (etil palmitat, etil linoleat, etil laurat) dengan waktu retensi masing-masing adalah 17,0, 18,6 , 18,7 menit. Berdasarkan hasil penelitian disimpulkan bioetanol tetes tebu dapat digunakan dalam sintesis biodiesel. Penggunaan bioetanol tetes tebu dalam sintesis biodiesel diperoleh karakteristik sesuai dengan Standar Nasional Indonesia (SNI) -04-7182-2006 kecuali viskositas.ABSTRACT: Biodiesel is an alternative energy for fossil fuel. It can be synthesized by esterification of waste cooking oil with alcohol. In this research, the used waste cooking oil contains 9.16 % FFA, while the alcohol used was bioethanol fermented from molase. The aim of this research was to characterize biodiesel produced from esterification and transesterification of used cooking oil with bioethanol molase. The ratios of oil to bioethanol were 1:1 (B1), 3:1 (B2), and 5:1 (B3). Based on the characterizations of the biodiesel, it was found that the density were 860.3, 865.3, 866.3 kg/m3 for B1, B2, B3 respectively. The viscosities were 19.138, 24.881, 25.359 mm2/s for B1, B2, B3 respectively.  The flash points were 138.50C, 93.50C, 212.50C for B1, B2, B3 respectively. The pour points were 6, 6, 90C for B1, B2, B3 respectively. The copperstrip corrosions were 1a, 1a, 1a for B1, B2, B3 respectively. The water content were 0.05, trace, 0.2 % v/v for B1, B2, B3, while B2 only contained trace amount of water. The gas chromatography analysis showed that the biodiesel produced contains ethyl palmitate, ethyl linoleate and ethyl laurate with retention time of 17.0, 18.6 , 18.7 minutes respectively. Based on the analyses, it can be concluded that biodiesel from used cooking oil and molase fulfils the Indonesian National Standard (SNI) -04-7182-2006, except for its viscosity.
KANDUNGAN CADMIUM DAN TIMBAL BUAH MANGROVE Bruguiera gymnorrhiza, Avicennia alba DAN Sonneratia caseolaris DARI MUARA SUNGAI MATI DAN DAERAH PEMOGAN, BADUNG, BALI-INDONESIA Luh Pt Widya Kalifika Devi; Iryanti Eka Suprihatin; Ketut Gede Dharma Putra
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (179.797 KB)

Abstract

ABSTRAK: Indonesia adalah salah satu negara yang mempunyai hutan mangrove terbesar di dunia.Balai Pengelolaan Hutan Mangrove Wilayah I Bali telah memberikan penyuluhan untuk mengolah bahan makanan dari buah mangrove yang mengambil bahan dasar dari buah mangrove Bruguiera gymnorrhiza, Avicennia alba dan Sonneratia caseolaris yang tumbuh di muara Sungai Mati yang berpotensi mengalami penurunan kualitas karena terkontaminasi limbah logam berat. Penelitian ini bertujuan untuk mempelajari kandungan logam berat buah bakau apakah layak untuk dikonsumsi berdasarkan baku mutu SK Dirjen POM No. 03725/B/SK/VII/1989 ditinjau dari kandungan logam Pb dan Cd. Penelitian dilakukan dengan mengambil sampel di kawasan muara Sungai Mati dan daerah Pemogan, daging buahnya didestruksi dengan metode destruksi basah dan diukur menggunakan Atomic Absorption Spectrophotometer (AAS) pada  283,30 nm untuk logam Pb dan 228,8 nm untuk logam Cd. Hasil penelitian menunjukkan kandungan total logam Pb dan Cd buah mangrove Bruguiera gymnorrhiza, Sonneratia caseolaris, Avicennia albadi daerah Sungai Mati dan di daerah Pemogan telah melebihi ambang batas baku mutu SK Dirjen POM No. 03725/B/SK/VII/1989.  ABSTRACT: Indonesia is one of the countries with the largest mangrove forest. Balai Pengelolaan Mangrove Area I Bali has provided counseling in food processing from mangrove fruits of Bruguiera gymnorrhiza, Avicennia alba and Sonneratia caseolaris that grow in the estuary of Sungai Mati. Sungai Mati is a river potentially contaminated by heavy metals waste derived from activities along the river banks. This research aims to study the heavy metal content of mangrove fruits and to determine if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS) at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

Page 1 of 1 | Total Record : 7

 1 

Filter by Year

2015 2015


Reset
Filter By Issues
All Issue Vol 12 No 1 (2024): Cakra Kimia (Indonesia E-Journal of Applied Chemistry) Vol 11 No 2 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 10 No 2 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 10 No 1 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 9 No 2 (2021): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 9 No 1 (2021): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 8 No 2 (2020): Volume 8, Nomor 2, 2020 Vol 8 No 1 (2020): Volume 8, Nomor 1, 2020 Vol 7 No 2 (2019): volume 7, Nomor 2, 2019 Vol 7 No 1 (2019): Volume 7, Nomor 1, 2019 Vol 6 No 2 (2018): Volume 6, Nomor 2, 2018 Vol 6 No 1 (2018): Volume 6, Nomor 1, 2018 Vol 5 No 2 (2017) Vol 5 No 1 (2017) Vol 4 No 2 (2016) Vol 4 No 1 (2016) Vol 3 No 3 (2015) Vol 3 No 2 (2015) Vol 2 No 2 (2014) Vol 2 No 1 (2014) Volume 1, No. 2, 2013 Volume 1, No. 1, 2013 More Issue