Claim Missing Document
Check
Articles

Construction of pY-Af Vector for Expression of Thermostable α-L-Arabinofuranosidase in Saccharomyces cerevisiae Wirajana, I Nengah; Puspaningsih, Ni Nyoman Tri; Wasito, Eddy Bagus; Kusuma, Soekry Erfan; Kimura, Tetsuya; Sakka, Kazuo
ANNALES BOGORIENSES Vol 14, No 2 (2010): Annales Bogorienses
Publisher : Research Center for Biotechnology - Indonesian Institute of Sciences (LIPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.1234/51

Abstract

In this research,  construction  of expression  vector  for thermostable α -L-arabinofuranosidase  in Saccharomyces cerevisiae was conducted. BJ1824 was conducted The  Escherichia coli/S. cerevisiae  shuttle vector, pYES2 was  used  as  parental  vector  in  construction.  The  abfA  gene  encoding  α-L- arabinofuranosidase  from Geobacillus  thermoleovorans  IT-08  was  amplified  by  PCR,  in  which  the  plasmid  pTP510 was  used  as  a template. The amplification product was treated with  SacI and XhoI and then subcloned to the pYES2 vector, which was previously digested with  SacI and  XhoI. The recombinant plasmid was designated as pY-Af and propagated  first  in  E.  coli  Top 10,  and  then  transformed  into  S.  cerevisiae  BJ1824.  For  α- Larabinofuranosidase (AbfA) production, the yeast transformants were grown in YNBG selective medium and YPG rich medium, using galactose as an inducer. The AbfA activity was assayed by measuring the amount of p-nitrophenol (pNP) released  from  p-nitrophenyl-α-L-arabinofuranoside  (pNPA) substrate at pH 6.0 and 70 C  for  30  min.  The  recombinant  AbfA  activity  was  detected  in  either  of  culture  medium  (0.98%),  cellassociated (14.17%) and intracellular (84.85%) when recombinant yeast was grown in YPG rich medium.Key words: α-L-arabinofuranosidase; Saccharomyces cerevisiae; expression vector
Identifikasi Mutasi Gen rpob Isolat MDR Mycobacterium tuberculosis di Bali dengan Metode Nested PCR*) Identification Of rpob Gene Mutation of MDR Mycobacterium tuberculosis Isolate in Bali Using Nested PCR Yowani, Sagung Chandra; Yowani, Sagung Chandra; Wirajana, I Nengah
JFIOnline | Print ISSN 1412-1107 | e-ISSN 2355-696X Vol 7, No 2 (2014)
Publisher : Indonesian Research Gateway

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK Tuberkulosis merupakan salah satu penyakit infeksi yang menjadi perhatian untuk ditangani pada program Millenium Development Goals (MDGs), terutama oleh meningkatnya kejadian Multi Drug Resistance (MDR_TB). Menurut WHO, resistensi terhadap rifampisin dan isoniazid telah dikategorikan sebagai MDR-TB. Dari beberapa penelitian, ditemukan bahwa hampir 90 % isolat yang resisten rifampisin, juga resisten terhadap isoniazid. Oleh karena itu,resistensi terhadap rifampisin dianggap sebagai marka penentu (surrogate marker) kejadian MDR-TB. Resistensi terhadap rifampisin dimediasi oleh adanya mutasi pada suatu region 81 bp (RRDR : Rifampicin Resistance Determinant Region) dari gen rpoB. Penelitian ini bertujuan utamanya untuk mengeksplorasi mutasi pada gen rpoB dari MDR-TB yang terjadi pada penderita Tuberkulosis di Bali. Isolat MDR-TB yang digunakan pada penelitian ini merupakanj koleksi Laboratorium Mikrobiologi RS Sanglah, Denpasar. Amplifikasi dilakukan dengan metode Nested Polymerase Chain Reaction menggunakan sepasang outer primer dan sepasang inner primer Hasil penelitian menunjukkan selain mutasi pada daerah RRDR, 5 dari 6 isolat yang dikerjakan memiliki titik mutasi yang sama yaitu pada kodon 418, dengan perubahan asam amino dari asam glutamat menjadi asam aspartat.Oleh karenanya, dapat disimpulkan bahwa terdapat missense mutation   Kata Kunci : Nested PCR, MDR-TB, Mutasi gen rpoB ABSTRACT Tuberculosis is one of the  infectious diseases that is important to be treated in Millenium Development Goals (MDGs) programme, mainly due to the increasing of Multidrug resistant tuberculosis (MDR-TB) cases. According to WHO, MDR-TB was defined as tuberculosis caused by strains of Mycobacterium tuberculosis that are resistant to at least isoniazid and rifampicin. Several studies found that nearly 90% of rifampin-resistant isolates, were also resistant to isoniazid. Therefore, resistance to rifampicin is a surrogate marker of MDR. Resistance to rifampicin is mediated by  mutation in a region of 81 bp (RRDR: Rifampicin Resistance Determinant Region) of the rpoB gene. The aim of this research mainly was to explore mutation of MDR-TB’ rpoB gene of tuberculosis patient in Bali. All MDR-TB isolates used for this research were the collection of Clinical Microbiology Laboratory Of Sanglah Hospital, Denpasar. Amplification were conducted by Nested Polymerase Chain Reaction methods using two pair of  inner and outer primers. The result of this study showed that except at RRDR, five of six isolates had one similar mutation at codon 418 from glutamic acid to aspartic acid. Therefore, it could be concluded that there has been a missense mutation in all isolates. Key words: Nested PCR, MDR-TB, r.poB gene mutation
OPTIMASI SUHU, pH DAN AMOBILISASI SELULASE DARI KONSORSIUM MIKROBA SELULOLITIK (KMS.UU1a) PADA KALSIUM ALGINAT Ro’yal Aini; I Nengah Wirajana; Ketut Ratnayani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 8 No 2 (2020): Volume 8, Nomor 2, 2020
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Tujuan penelitian ini adalah untuk mengetahui suhu dan pH optimum selulase dari konsorsium mikroba selulolitik KMS.UU1a dalam kondisi bebas dan terambobilisasi, konsentrasi kalsium alginat optimum untuk amobilisasi selulase, serta keberulangan (reusability) dan efisiensi selulase terambilisasi. Pengukuran aktivitas selulase dilakukan berdasarkan kandungan gula pereduksi sebelum dan sesudah reaksi enzimatis dengan metode Dinitrosalycilic acid (DNS). Aktivitas selulase KMS.UU1a baik dalam kondisi bebas dan teramobilisasi diuji pada suhu 35, 40, 45, 50, 55 dan 60 oC; dan pH 4, 5, 6, 7, 8, dan 9. Konsentrasi sodium alginat yang digunakan dalam proses amobilisasi selulase KMS.UU1a adalah 0,5, 1,0, 1,5, 2,0, 2,5 dan 3,0 % (b/v) dalam CaCl2 0,15 M. Uji keberulangan dilakukan dengan mengukur aktivitas selulase KMS.UU1a amobil pada 4 (empat) kali pemakaian enzim, sedangkan efisiensi diketahui dari uji aktivitas selulase bebas sebelum dan setelah amobilisasi. Konsentrasi kalsium alginat optimum untuk amobilisasi selulase KMS.UU1a adalah 2,0 % (b/v). Suhu optimum selulase KMS.UU1a bebas lebih rendah (40 oC) dibandingkan dengan selulase amobil (45 oC), dengan aktivitas selulase bebas 0,005636 U/mL, lebih tinggi dibandingkan dengan aktivitas selulase amobil 0,003617 U/mL. Selulase KMS.UU1a bebas dan amobil sama-sama memiliki pH optimum 6,0 dengan aktivitas selulase berturut-turut sebesar 0,006444 U/mL dan 0,003771 U/mL. Keberulangan dilihat dari besarnya aktivitas selulase KMS.UU1a amobil pada pemakaian kedua, ketiga, dan keempat terhadap pemakaian pertama berturut-turut sebesar 70,53; 61,66; dan 23,92 %. Efisiensi amobilisasi selulase KMS.UU1a pada kalsium alginate diperoleh sebesar 63,8711 %. ABSTRACT: The purpose of this study was to determine the optimum temperature and pH of cellulase from the KMS.UU1a cellulolytic microbial consortium in free and immobilized conditions, the optimum percentage of calcium alginate used for cellulase immobilization, reusability and efficiency of immobilized cellulase. The enzyme activity was determined by the Dinitrosalycilic acid (DNS) method KMS.UU1a cellulase activity in both free and immobilized conditions was tested at temperatures of 35, 40, 45, 50, 55 and 60 oC; and pH 4, 5, 6, 7, 8, and 9. The concentration of alginate used in the immobilization process of KMS.UU1a cellulase was 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0% (w/v) in 0.15 M CaCl2, was done by measuring the immobilized KMS.UU1a cellulase activity in 4 (four) enzyme usage cycles, while the efficiency was known from the cellulase free activity test before and after immobilization. The optimum concentration of calcium alginate for immobilization of KMS.UU1a cellulase was 2.0% (w/v). The optimum temperature of free KMS.UU1a cellulases was lower (40 oC) compared to immobilized cellulases (45 oC), with free cellulase activity of 0.005636 U / mL, higher than that of immobilized cellulases of 0.003617 U / mL. Both free and immobilized KMS.UU1a cellulases had an optimum pH of 6.0, with cellulase activity of 0.006444 U/mL and 0.003771 U/ mL, respectively. Repetition can be seen from the immobilized KMS.UU1a cellulase activity in the second, third, and fourth cycles of the first cycle respectively of 70.53; 61.66; and 23.92%. The immobilization efficiency of KMS.UU1a cellulase on calcium alginate was 63.8711%.
PENGARUH MINYAK JELANTAH DAN WAKTU INKUBASI TERHADAP AKTIVITAS LIPASE PADA TANAH HUTAN MANGROVE PANTAI TABLOLONG KUPANG Gusti A Malelak; I Nengah Wirajana; I Gede Mahardika
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 2 No 2 (2014)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (328.854 KB)

Abstract

ABSTRAK: Penambahan minyak pada tanah umumnya dapat menginduksi ekspresi lipase mikroorganisme lipolitik dalam tanah. Tujuan penelitian ini adalah untuk mengetahui pengaruh penambahan minyak jelantah dan waktu inkubasi serta interaksi antara keduanya terhadap aktivitas lipase pada tanah hutan mangrove Pantai Tablolong Kabupaten Kupang, Nusa Tenggara Timur (NTT). Penelitian ini termasuk dalam True Experiment dengan Rancangan Acak Lengkap (RAL) pola faktorial yang terdiri atas 2 faktor. Faktor pertama adalah waktu inkubasi (tanpa dan dengan inkubasi selama 1, 2, 3, 4, dan 5 hari); dan faktor kedua adalah pengaruh minyak jelantah (tanpa dan dengan penambahan minyak jelantah 1,96; 3,84; dan 5,65% [v/v]). Penentuan aktivitas lipase dilakukan dengan metode titrimetri dan data yang dihasilkan diolah menggunakan metode anova 2 (dua) arah. Hasil penelitian menunjukkan bahwa penambahan minyak jelantah dan waktu inkubasi dapat meningkatkan aktivitas lipase pada tanah hutan mangrove. Minyak jelantah dapat digunakan sebagai penginduksi lipase mikroorganisme lipolitik dalam tanah hutan mangrove, tetapi tidak dapat digunakan lebih tinggi dari 3,84% (v/v). Aktivitas lipase tertinggi diperoleh 1,233 U/mL pada waktu inkubasi selama lima hari. Hasil analisis data menunjukkan tidak ada interaksi antara waktu inkubasi dan penambahan minyak jelantah terhadap aktivitas lipase pada tanah hutan mangrove.ABSTRACT: Addition of oil on soil can usually induce lipase expression of lipolitic microorganism on the soil. The aim of this research was to know the effect of cooking oil waste addition and incubation period varies on the activity of lipase from mangrove forest soil of Tablolong Beach, Kupang, Nusa Tenggara Timur (NTT). This research was in True Experiment with completion random design of factorial model that contains 2 factors. The first factor was incubation period (0, 1, 2, 3, 4, and 5 days); and the second factor was the addition of cooking oil waste (0; 1.96; 3.84; and 5.65% [v/v]). The activities of lipase were determined by titrimetric method. Data of this study was analyzed by using anova two factors. The results of this research showed that the addition of cooking oil waste and incubation period could increase the lipase activity on the mangrove forest soil. The cooking oil waste could be used as inducer of lipase from lipolitic microorganism on mangrove forest soil, but it could not be used more than 3.84% (v/v). The highest lipase activity was 1.233 U/mL on incubation period for five days. The result of data analysis showed no interaction between incubation period and addition of cooking oil waste on lipase activity from mangrove forest soil. 
DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB) DENGAN METODE POLYMERASE CHAIN REACTION Luk Ketut Budi Maitriani; I Nengah Wirajana; Sagung Chandra Yowani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (230.013 KB)

Abstract

ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen). Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB) mencakup kodon 94 (nukleotida 280-282). Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077). Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR). Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit) serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen), meliputi: panjang primer, %GC, Tm (melting temperature), interaksi primer (dimers dan hairpins), stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA) 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.  ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen). The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB) clinical isolates include codon 94 (nucleotide 280-282). Codon 94 of inhA gene is frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077). Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes) with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen) such as: primer length, %GC, Tm (melting temperature), primers interaction (dimers and hairpins), stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA) 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS) at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.  
SELULASE DAN AMILASE DARI DAUN LONTAR (Borassus flabelliformis) YANG TELAH LAPUK SERTA UJI INHIBISI DENGAN MINYAK SEREH DAN CENGKEH Ida Bagus Putu Eristya Putra; I Nengah Wirajana; Anak Agung Istri Agung Mayun Laksmiwati
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 7 No 2 (2019): volume 7, Nomor 2, 2019
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (438.409 KB)

Abstract

ABSTRAK: Pelapukan naskah lontar salah satunya disebabkan oleh mikroba yang menghasilkan enzim pendegradasi selulosa dan amilum yang terkandung dalam daun siwalan (lontar). Tujuan penelitian ini adalah untuk menentukan aktivitas selulase dan amilase dari mikroba selulolitik dan amilolitik yang diisolasi dari lontar yang telah lapuk, serta mengetahui kemampuan minyak sereh dan cengkeh menginhibisi aktivitas selulase dan amilase dari kedua jenis mikroba tersebut. Isolasi mikroba selulolitik dan amilolitik dari lontar yang telah lapuk dilakukan dengan metode pengenceran dan dikultivasi dalam media yang mengandung substrat spesifik. Substrat carboxymethyl cellulose (CMC) digunakan untuk mikroba selulolitik, sedangkan substrat amilum untuk mikroba amilolitik. Mikroba selulolitik dideteksi dengan adanya zona bening di sekitar koloni mikroba setelah ditambahkan larutan congo red 0,1% (b/v), sedangkan untuk mikroba amilolitik ditambahkan dengan larutan iodin 0,1% (b/v). Aktivitas selulase dan amilase ditentukan berdasarkan gula pereduksi yang dihasilkan dari reaksi enzim-substrat setelah direaksikan reagen dinitro salisilat (DNS) dan ditentukan dengan spektrofotometri UV-Vis. Hasil penelitian diperoleh mikroba selulolitik (C3B) dengan aktivitas selulase sebesar 0,068 U/mL; dan mikroba amilolitik (A5A) dengan aktivitas amilase sebesar 0,827 U/mL. Uji inhibisi menggunakan minyak sereh menunjukkan penurunan aktivitas selulase 4,41% dan penurunan aktivitas amilase 30,96%. Uji inhibisi menggunakan minyak cengkeh menunjukkan penurunan aktivitas amilase 92,50%. Hasil ini mengindikasikan adanya potensi minyak sereh dan cengkeh sebagai bahan untuk konservasi lontar. Kata kunci: inhibitor; aktivitas enzim; selulase; dan amilase ABSTRACT: Weathering of the manuscript was caused by one of the microbes that produced cellulose and starch degrading enzymes contained in the palm-leaf (lontar). The purpose of this study was to determine the activity of cellulase and amylase from cellulolytic and amylolytic microbes isolated from weathered palm, also know the ability of lemongrass and clove oil to inhibit cellulase and amylase activity from both types of microbes. Isolation of cellulolytic and amylolytic microbes from decaying palms was carried out by a dilution method and cultivated in media containing specific substrates. Carboxymethyl cellulose (CMC) substrate is used for cellulolytic microbes, while starch substrates for amylolytic microbes. Cellulolytic microbes were detected by the presence of clear zones around the microbial colonies after adding 0.1% (w/v) congo red solution, while for amylolytic microbes added with 0.1% (w/v) iodine solution. Cellulase and amylase activity was determined based on reducing sugars produced from enzyme-substrate reactions after reacting dinitro salicylate (DNS) reagents and determined by UV-Vis spectrophotometry. The results obtained by cellulolytic microbes (C3B) with cellulase activity of 0.068 U/mL; and amylolytic microbes (A5A) with amylase activity of 0.827 U / mL. Inhibition test using lemongrass oil showed a decrease in cellulase activity 4.41% and decreased amylase activity 30.96%. Inhibition testing using clove oil showed a 92.50% decrease in amylase activity. These results indicate the potential for lemongrass and clove oil as ingredients for palm-leaf conservation.
FRAKSINASI SELULASE MIKROBA SELULOLITIK DENGAN AMONIUM SULFAT DAN AMOBILISASI PADA AGAR-AGAR KOMERSIAL Oka Ratnayani; Putu Elvira Yulianthi; I Nengah Wirajana
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 9 No 1 (2021): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Penggunaan selulase yang semakin meningkat telah mendorong berbagai studi tentang eksplorasi, pemurnian, dan amobilisasi selulase. Penelitian ini bertujuan untuk fraksinasi ekstrak kasar selulase yang diperoleh dari mikroba selulolitik serta amobilisasinya pada agar-agar komersial. Produksi selulase dari mikroba selulolitik U3.1 dilakukan pada media yang mengandung substrat spesifik yaitu Carboxymethyl cellulose (CMC). Ekstrak kasar selulase dimurnikan dengan metode fraksinasi amonium sulfat dan dialisis. Ekstrak kasar selulase dan selulase murni diamobilisasi pada matrik agar-agar. Aktivitas selulase ditentukan berdasarkan analisis gula pereduksi yang dihasilkan dari reaksi enzimatis dengan reagen DNS. Kadar protein total diukur dengan metode Biuret. Aktivitas spesifik ekstrak kasar selulase dan selulase murni diperoleh berdasarkan rasio antara aktivitas selulase dengan kadar protein total tiap fraksi selulase. Fraksi 2 (selulase yang dimurnikan dengan garam amonium sulfat dengan tingkat kejenuhan 20-40%) memiliki aktivitas spesifik selulase tertinggi sebesar 3,3977 x 10-3 U/µg, dengan tingkat kemurnian 21,0317 kali dibandingkan ekstrak kasar selulase. Konsentrasi agar-agar optimum untuk amobilisasi ekstrak kasar selulase dan selulase murni adalah masing- masing 2% (b/v) dan 3% (b/v) dengan efisiensi amobil sebesar 13,99% dan 51,26%. ABSTRACT: The increasing use of cellulase has encouraged various studies on exploration, purification and immobilization of the enzyme. This study aimed to fractionate the crude extract of cellulase obtained from cellulolytic microbe as well as immobilize it into commercial agar. The cellulase production from cellulolytic microbe U3.1 was carried out on the media containing a specific substrate of Carboxymethyl cellulose (CMC). The crude extract of cellulase was purified by fractionation of ammonium sulfate and dialysis. The crude extract and the pure cellulase were immobilized into the agar matrix. Cellulase activity was determined based on the analysis of reducing sugars produced by enzymatic reaction with DNS reagent. The total protein content was measured by using the Biuret method. The specific activity of the crude extract and the pure cellulase was obtained from the ratio of the cellulase activity to the total protein of each fraction. Fraction 2 (cellulase purified with 20-40% saturation of ammonium sulfate) had the highest specific activity of 3.3977 x 10-3 U/µg with the purity level increased by 21.0317 times compared to the crude extract of cellulase. The optimum agar concentration for immobilization of the crude extract and the pure cellulase was 2% (b/v) and 3% (b/v) with the immobilization efficiency of 13.99% and 51.26%, respectively.
PEMANFAATAN POLIPLEKS KHITOSAN-pDNA DALAM TRANSFORMASI SEL Escherechia coli I Putu Mahendra; I Nengah Wirajana; James Sibarani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 2 No 2 (2014)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (278.062 KB)

Abstract

ABSTRAK: Penelitian berkaitan dengan pemanfaatan khitosan sebagai pelindung DNA plasmid (pDNA) dalam proses transformasi sel pada sel inang Escherechia coli telah dilakukan yang bertujuan untuk memperoleh polipleks yang stabil dan untuk mengetahui dapat atau tidaknya diperoleh sel transforman dengan menggunakan polipleks. Penelitian ini diawali dengan melakukan isolasi khitosan dari limbah kulit udang yang memberikan derajat deasetilasi 83,30%. Selanjutnya dilakukan isolasi DNA plasmid dengan menggunakan kit dari Qiagen yang memberikan konsentrasi DNA plasmid 37,8 ?g/mL. Polipleks yang disintesis dari khitosan-DNA plasmid memberikan nilai potensial Zeta 9,63 mV. Penerapan polipleks dalam proses transformasi sel menunjukkan hasil positif, yang mana sel E. coli yang telah disisipkan material polipleks dan dibiakkan pada media ampisilin dapat tetap bertahan hidup, hal ini menunjukkan bahwa proses transformasi dengan polipleks khitosan-DNA plasmid telah berhasil dilakukan. Kata kunci: Khitosan, DNA Plasmid, Polipleks, Transformasi Sel   ABSTRACT: The research about the application of chitosan as the carrier and protecting agent for the plasmid DNA (pDNA) in the cells transformation process on Escherechia coli had been carried out, the aim of this research was to obtain stabile and nanosize polyplex from chitosan and plasmid DNA and to get the information if the cells transformation process could be done using the polyplex. The chitosan was isolated from shrimp's shelled deacetylation degree of 83,3%. The concentration of plasmid DNA was 36,75 ug/mL isolated using a Qiagen kit. The chitosan-plasmid DNA polyplex had the Zeta potential of 9,63 mV. Further, the application of the polyplex on the transformation process of E. coli cells showed a positive result where E. coli cells that had been inserted with the polyplex were bred in amphicillin media still survived. This fact showed that the cells transformation process using the polyplex was successfully performed. Keywords: Chitosan, Plasmid DNA, Polyplex, Cell Transformation
ISOLASI DNA METAGENOMIK DARI SPUTUM PASIEN TUBERKULOSIS DAN AMPLIFIKASI DENGAN PRIMER PROMOTER inhA Ni Made Yustikarini; Sagung Chandra Yowani; I Nengah Wirajana
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (220.918 KB)

Abstract

 ABSTRAK: Penelitian ini bertujuan untuk memperoleh DNA metagenomik dari sputum pasien tuberkulosis dan mengamplifikasi dengan menggunakan primer promoter inhA. Penelitian ini dilakukan dalam tiga tahap, yaitu: isolasi DNA metagenomik dari sputum pasien tuberkulosis, amplifikasi menggunakan sepasang primer promoter inhA dari M. tuberculosis dengan metode PCR, dan elektroforesis gel agarosa terhadap hasil amplifikasi. Elektroforegram hasil amplifikasi menunjukkan bahwa isolasi DNA metagenomik dari sputum pasien tuberkulosis telah berhasil dilakukan dengan metode modifikasi maupun dengan kit. Ukuran pita fragmen DNA sekitar 284 bp dari hasil amplifikasi (amplikon) yang diperoleh dari DNA metagenomik sputum P.48B, P.46B, dan P.47B  MDR- TB  merupakan ukuran yang sesuai dengan bagaian dari daerah promoter inhA M. tuberculosis. Ukuran amplikon ini sama dengan ukuran amplikon yang sebelumnya telah diperoleh dari amplifikasi terhadap DNA M. tuberculosis oleh peneliti sebelumnya dengan menggunakan primer yang sama.ABSTRACT: The aims of this research were to obtain metagenomic DNA from sputum of tuberculosis patients and to amplify it by using inhA promoter primer. This research was conducted in three steps covering the DNA metagenomic isolation from sputum of tuberculosis patients, amplification of inhA promoter region of M. tuberculosis by using specific primer pair by PCR (Polymerase Chain Reaction) method, and electrophoresis of amplified products using agarose gel. The electrophoregram of amplified products showed that the metagenomic DNA isolation from sputum of tuberculosis patients was successfully carried out both by the modified method and by a kit. The size of DNA fragment bands about 284 bp of amplified products (amplicons) which obtained from the metagenomic DNAs of P.48B, P.46B, P.47B sputum was suitable size with a part of inhA promoter region of M. tuberculosis. The size of these amplicons was the same size with the amplicons from M. tuberculosis DNA reported by other researchers.
UJI POTENSI EKSTRAK ETANOL DAUN GEDI (Abelmoschus manihot L.) TERHADAP AKTIVITAS ANTIOKSIDAN DAN PENURUNAN KADAR GLUKOSA DARAH TIKUS PUTIH GALUR WISTAR YANG DIINDUKSI ALOKSAN I Ketut Gede Dharma Dewantara; I Wayan Gede Gunawan; I Nengah Wirajana
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 5 No 2 (2017)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (676.285 KB)

Abstract

ABSTRAK: Penelitian ini bertujuan untuk mengetahui potensi ekstrak etanol daun gedi (Abelmoschusmanihot L.) sebagai antioksidan dan terhadap penurunan kadar glukosa darah tikus putih galur wistar yang diinduksi aloksan. Uji aktivitas antioksidan dari ekstrak etanol daun gedi menggunakan metode DPPH dengan konsentrasi sampel yaitu 2, 4, 6, 8, dan 10 ppm serta menggunakan asam askorbat sebagai senyawa standar. Uji penurunan glukosa darah pada tikus wistar yang diinduksi aloksan menggunakan 25 ekor tikus wistar yang dibagi menjadi 5 kelompok yaitu dua kelompok kontrol dan tiga kelompok perlakuan dengan beragam dosis ekstrak daun gedi. Dosis yang digunakan pada masing-masing kelompok perlakuan adalah 5 mg/kgBB (P2), 10 mg/kgBB (P3), dan 15 mg/kgBB (P4). Kondisi hiperglikemia pada semua kelompok kontrol dan perlakuan diinduksi dengan aloksan dosis 125 mg/kgBB. Hasil penelitian uji antioksidan menunjukkan bahwa ekstrak etanol daun gedi memiliki nilai IC50 sebesar 31,29 ppm. Hasil uji penurunan kadar glukosa darah pada kelompok kontrol positif (P1) sebesar 138,8 mg/dL, kelompok perlakuan P2 sebesar 72 mg/dL; P3 sebesar 97,4 mg/dL dan P4 sebesar 137,6 mg/dL. Perbedaan penurunan rerata kadar glukosa ini dianalisis dengan metode One Way ANOVA dan didapatkan hasil bahwa semua data dari kelompok memiliki perbedaan yang signifikan ABSTRACT: The purposes of this research are to determine the potential of gedi leaves (Abelmoschus manihot L.) ethanol extract as antioxidant and on the reduction blood glucose level of wistar strain white rats induced by alloxan. The antioxidant activity test of ethanol extract of gedi leaves with concentration of 2, 4, 6, 8 and 10 ppm was conducted by using DPPH method with ascorbic acid as standard compound. The reduction test of alloxan-induced blood glucose in rats was conducted with 25 rats divided into 5 group which are two control groups and three treatment groups treated with different doses of gedi leaves ethanol extracts. The doses used on each the treatment groups were 5 mg/kgBW (P2), 10 mg/kgBW (P3), and 15 mg/kgBW (P4). The hyperglycemia condition of all groups was induced by alloxan at dose of 125 mg/kgBW. The antioxidant activity test of gedi leaves ethanol extract showed that the IC50 was 31.29 ppm. Moreover, the intake of gedi leaves ethanol extract decreased the blood glucose of positive control group, P2, P3 and P4 of 138.8 mg/dL, 72 mg/dL, 97.4 mg/dL, and 137.6 mg/dL respectively. The difference of blood glucose reduction had been tested with One Way ANOVA method which showed the significant different between the groups.
Co-Authors A. A. B. Putra Anak Agung Istri Agung Mayun Laksmiwati D. Rizkiyanti Darma Asih Yuliana Dewi Andayani Farmawati Dewi, I Gusti Ayu Agung Gangga Samala Dewi, Ni Komang Ayu Cintia Diah Suci Eddy Bagus Wasito Gusti A Malelak H.M. Soekry Erfan Kusuma I Gede Mahardika I Gusti Ngurah Bagus Andre Hartawan I Ketut Gede Dharma Dewantara I Made Agus Gelgel Wirasuta I Made Agus Kusuma Adi I P. J. D. A. Suartama I Putu Mahendra I W BUDIARSA SUYASA I Wayan Gede Gunawan I Wayan Suarsa I. A. Gede Widihati Ida Ayu Ratih Dwi Nugraha Putri Ida Bagus Amertha Putra Manuaba Ida Bagus Putra Manuaba Ida Bagus Putu Eristya Putra Ika Kurniawati Indra Juana Adikara Inten Hardianti Nizar Iryanti Eka Suprihatin Ismail Ware James Sibarani Joko Tri Wibowo Joko Tri Wibowo, Joko Tri Kazuo Sakka Ketut Ratnayani Khisan Qamariya Kimura, Tetsuya Kimura, Tetsuya Kusuma, Soekry Erfan Kusuma, Soekry Erfan Listyaningrum, Ni Made Diah Luh De Dwi Jayanthi Luk Ketut Budi Maitriani M. Manurung Made Arsa Made Dharmesti Wijaya Made Rai Dwitya Wiradiputra Mirawati N.K.W. N. M. T. Juliasari N. W. Bogoriani Ni Kadek Dwijayanti Ni Komang Ariati Ni Komang Diah Eka Witantri Ni Komang Lia Wahyuni Ni Luh Md. Widayantini Ni Luh Putu Mustika Praptiwi Ni Made Suaniti Ni Made Widya Wulandari Ni Made Yustikarini Ni Nengah Kartini Asih Ni Nyoman Tri Puspaningsih Ni Putu Ariantari Ni Putu Citra Anggryni Sugitha Ni Putu Eka Leliqia Ni Putu Eka Leliqia Ni Putu Frida Oktaningtias Widiarthi Ni Putu Rahayu Artini O. Ratnayani Oka Ratnayani P. Suarya Pradnyaniti, D.G Putra, Pramana Kumala Putri, Ni Wayan Prasanthi Swarna Putu Elvira Yulianthi Putu Suarya R. R. Sirait Ro’yal Aini Sagun Chandra Yowani Sakka, Kazuo Sakka, Kazuo Satriya Putra Prakoso Soekry Erfan Kusuma Tetsuya Kimura Wahyu Dwijani Sulihingtyas Y. H. Pratiwi