Article Per Year (5 Year)
p-Index From 2021 - 2026
1.203
P-Index
This Author published in this journals
All Journal KUKILA Science and Technology Indonesia Jurnal Analis Kesehatan Seminar Nasional Lahan Suboptimal PARENTAS: Jurnal Mahasiswa Pendidikan Teknologi dan Kejuruan MAHESA : Malahayati Health Student Journal Jurnal Rekonstruksi dan Estetik SIMAS JURNAL PENGABDIAN MASYARAKAT
Doni Setiawan
Unknown Affiliation
Religion Agriculture, Biological Sciences & Forestry Automotive Engineering Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Civil Engineering, Building, Construction & Architecture Dentistry Education Engineering Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Library & Information Science Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Nursing Physics Public Health Transportation Other

Published : 9 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 9 Documents
Search

 1 
COMPLIANCE LEVEL OF IMPLEMENTATION OF OCCUPTIONAL SAFETY AND HEALTH MANAGEMENT SYSTEM (SMK3) IN CONCRETE WORKSHOP DEPARTMENT OF BUILDING CONSTRUCTION, SANITATION AND MAINTENANCE (KGSP) OF SMK NEGERI 1 PALANGKA RAYA Doni Setiawan; Revianti Coenraad
PARENTAS: Jurnal Mahasiswa Pendidikan Teknologi dan Kejuruan Vol. 6 No. 1 (2020): Journal Parentas Edisi Januari-Juni 2020
Publisher : Jurusan Pendidikan Teknologi Dan Kejuruan

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This study aims to find out the complete facilities of Personal Protective Equipment (PPE) and Workshop Safety in accordance with school standards and the Compliance Level of Implementation of Occupational Safety and Health Management System (SMK3) in Concrete Workshop, Building Construction, Sanitation and Maintenance (KGSP) SMK Negeri 1 Palangka Raya. Based on the results of the indicator achievement in the completeness of Personal Protective Equipment (PPE) and Workshop Safety at Concrete Workshop, Department of Building Construction, Sanitation and Maintenance (KGSP) of SMK Negeri 1 Palangka Raya, it has 49.9% of achievement with less criteria. This will be the evaluation reference and the follow-up for workshops and schools to provide more attention on the protection facilities being more complete. Whereas the achievement of the Occupational Health and Safety Management System in the Concrete Workshop, Building, Sanitation and Maintenance (KGSP) Department which is 63.1% has entered into sufficient categories. Due to the implementation of K3 has been achieved, it is necessary to increase the implementation of K3 in accordance with the K3 management system.
Hunting of a very large aggregation of Eyebrowed Thrushes Turdus obscurus in Sumatra Muhammad Iqbal; . Ajiman; Richard Noske; Doni Setiawan
KUKILA Vol. 17 No. 2 (2014)
Publisher : Indonesian Ornithologists’ Union

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Kinetic and Thermodynamic Adsorption of Cr(VI) onto Dried Oscillatoria Splendida in Aqueous Solution Risfidian Mohadi; Doni Setiawan; Hilda Zulkifli
Science and Technology Indonesia Vol. 3 No. 4 (2018): October
Publisher : Research Center of Inorganic Materials and Coordination Complexes, FMIPA Universitas Sriwijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (618.436 KB) | DOI: 10.26554/sti.2018.3.4.195-198

Abstract

Kinetic and thermodynamic adsorption study of Cr(VI) ion in aqueous solutions by dried Oscillatoria Splendida biomass was investigated in the batch system. The Oscillatoria Splendida was isolated and cultured from algae swamp ecosystem in South Sumatera. The adsorption properties of Cr(VI) onto dried Oscillatoria Splendida biomass was studied by the influences of contact time, initial Cr(VI) ion concentration and temperature of reaction. The experimental results were the rate of adsorption followed the second-order kinetic model with the rate of reaction k2 is 0.00181 mg g-1 min-1 and the adsorption thermodynamic agree to the Langmuir’s model with amount of Cr(VI) removed from aqueous solution increased with increasing Cr(VI) concentration with the higher adsorption energy was 8.46 kJ/mol at 50 °C.
PEDIATRIC OCULAR TRAUMA MANAGEMENT: A CASE STUDY OF EFFECTIVE INTRA-ORBITAL FOREIGN BODY IOFB EXTRACTION Doni Setiawan; Liesa Z Subuh; Alexandria Stephanie Suparman; Yugos Juli Fitra
Jurnal Rekonstruksi dan Estetik Vol. 9 No. 1 (2024): Jurnal Rekonstruksi dan Estetik, June 2024
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jre.v9i1.49570

Abstract

Highlights: The rare nature of Orbitocranial Injury with Intraorbital Foreign Body (IOFB). Utilizing a 3D Head CT Scan to ascertain the precise location of the IOFB and its impact on anatomical structures is pivotal in shaping immediate treatment strategies, thereby reducing the potential for complications. Abstract: Introduction:  Penetrating intraorbital foreign body (IOFB) injuries are a rare form of traumatic injury. Recognized as a surgical emergency, meticulous history-taking and a thorough examination are essential for determining the trauma's mechanism and cause, facilitating accurate diagnosis and effective disease management. Case Illustration: In the emergency room, a 5-year-old female patient was presented with a craniofacial injury resulting from an IOFB. An evacuation procedure, conducted through a subsidiary incision, was performed to extract the foreign body. Interestingly, the object removed from the orbital cavity was a plastic foreign body, initially suspected to be a fractured orbital bone. Discussion: The clinical presentation, management, and outcomes of orbital foreign body injuries can differ based on the material composition of the foreign body. In cases of intraorbital foreign body trauma, the primary treatment goal is foreign body removal. Conclusion: Precise and accurate initial management in the emergency department is crucial. Early diagnosis, aided by a 3D head CT scan, is instrumental in locating the IOFB and identifying the involved anatomical structures. This, in turn, enables timely treatment decisions to minimize the risk of complications.
A CASE REPORT: THE STAGED RETRO AURICULAR FLAPS FOR AURICLE RECONSTRUCTION AFTER TRAUMATIC AMPUTATIONS Suparman, Alexandria Stephanie; Doni Setiawan; Yugos Juli Fitra
Jurnal Rekonstruksi dan Estetik Vol. 8 No. 1 (2023): Jurnal Rekonstruksi dan Estetik, June 2023
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jre.v8i1.45402

Abstract

Highlights: Instances of severe ear injuries are uncommon. The paragraph explores the efficacy of the staged retro-auricular flap (SRF) as a proficient approach to ear reconstruction. SRF demonstrates the ability to successfully reinstate the ear's dimensions, contour, and functionality, yielding highly satisfactory functional and aesthetic outcomes. Abstract: Introduction:  A complete amputation or other severe auricular injury is rare. The amputated ear also presents a significant problem for the plastic surgeon. Case Illustration: A 29-year-old man had his left ear amputated due to trauma presented. He cut off his ear to get rid of the whisper because he has a history of psychiatric illnesses and complaints about hearing them. The remaining portion of the cartilage that was still linked to the ear attachment area was sutured to the preserved cartilage. The defect is covered using a stage pedicle flap. A skin transplant was used to close the donor flap's retro-auricular defect, which was its secondary defect. Discussion: A random-pattern flap with an abundant vascular supply is the staged retro-auricular flap (SRF). This flap's main disadvantage is the two-stage process required to complete it. Excellent cosmetic outcomes can be achieved by matching skin color and texture well in the postauricular sulcus, mastoid area, and posterior ear. Conclusion: SRF is an efficient ear reconstruction technique that offers relatively little operational morbidity and can restore the ear's size and shape with good to exceptional functional and cosmetic results when used on appropriately chosen helical ear abnormalities.
Analisis Faktor Pengetahuan, Gaya Hidup dan Kebersihan Lingkungan Terhadap Risiko Penularan Penyakit Demam Berdarah Dengue (DBD) Suhartati, Rochmanah; Muhamad Fardan S; Doni Setiawan; Muhammad Hadi Sulhan
Jurnal Analis Kesehatan Vol. 14 No. 1 (2025): JURNAL ANALIS KESEHATAN
Publisher : Department of Health Analyst, Politeknik Kesehatan, Kementerian Kesehatan Tanjungkarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26630/jak.v14i1.4868

Abstract

Peningkatan kasus Demam Berdarah Dengue (DBD) di Indonesia, termasuk di Kelurahan Bungursari, Tasikmalaya menjadi perhatian serius dalam upaya pencegahan penyakit menular. Penelitian ini bertujuan untuk menganalisis pengaruh kebersihan lingkungan dan kebiasaan hidup masyarakat terhadap risiko penyebaran DBD. Metode penelitian yang digunakan adalah deskriptif kuantitatif dengan pendekatan survei melalui kuesioner tertutup yang diisi oleh 49 responden. Hasil penelitian menunjukkan bahwa 87,8% responden memiliki pengetahuan baik tentang gejala DBD, sebanyak 81,6% menerapkan gaya hidup sehat, dan 85,7% menjaga kebersihan lingkungan. Hasil pengolahan data statistik menggunakan SPSS menunjukan bahwa hasil analisis Inferensial regresi logistik menunjukan variabel Pengetahuan DBD Odds Ratio: 0,30 dan p=0,045, Gaya Hidup sehat Odds Ratio 0,45 dan p=0,021 sedangkan Kebersihan Lingkungan Odds Ratio 0,22 dan p=0,003 artinya bahwa ketiga variabel (pengetahuan, gaya hidup sehat, kebersihan lingkungan) secara signifikan memengaruhi risiko penyebaran penyakit DBD. Penyuluhan yang dilakukan dalam penelitian ini terbukti efektif meningkatkan pemahaman masyarakat, sebagaimana ditunjukkan oleh tingginya antusiasme peserta selama kegiatan. Hasil penelitian disimpulkan bahwa pentingnya strategi pencegahan DBD berbasis edukasi mengenai kebersihan lingkungan dan penerapan pola hidup sehat dalam masyarakat.
Analisis Bioinformatika Gen tprK sebagai Target Deteksi Treponema pallidum Menggunakan Pendekatan In Silico PCR Rivana Ariyadi; Muhammad Abdul Hadi Rabbani; Doni Setiawan; Nabil Ridla Firdaus
MAHESA : Malahayati Health Student Journal Vol 6, No 10 (2026): Volume 6 Nomor 10 (2026)
Publisher : Universitas Malahayati

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33024/mahesa.v6i10.27956

Abstract

ABSTRACT Sexually transmitted infections (STIs) remain a significant public health problem in Indonesia and worldwide, with syphilis and gonorrhea being two diseases that often occur concurrently. Early diagnosis of syphilis is crucial for preventing serious complications; however, commonly used serological tests for Treponema pallidum have limitations due to their lack of specificity. Bioinformatics offers a solution for developing more accurate molecular detection methods through genomic analysis and computer-aided primer design. This study aims to perform a bioinformatics analysis of the Treponema pallidum tprK gene as a target for molecular detection, as well as to design and validate specific primer pairs using an in silico PCR approach capable of distinguishing T. pallidum from Neisseria gonorrhoeae. The study was conducted using a bioinformatics approach through several stages: extraction and analysis of the tprK gene sequence from the GenBank database (AF343921.1); translation of the nucleotide sequence into a protein using BioEdit; modeling of the three-dimensional structure of the TprK protein using SWISS-MODEL; design and selection of primer pairs using Primer3Plus with parameters of 18–22 bp, Tm 55–60°C, and GC content 40–60%, analysis of primer characteristics using OligoCalc, and specificity testing via in silico PCR against 18 Treponema spp. genomes and 18 Neisseria spp. genomes. Bioinformatics analysis showed that the tprK gene (1,461 bp) encodes a 486-amino-acid protein with a stable 3-D structure. Of the five pairs of candidate primers designed, Pair 4 (forward: ACCGGGAAGTAAATGGCTGG, reverse: ATGCCCCTACGAATTGCCAA) and Pair 5 (forward: TTATGGGGCCTACCTGACCA, reverse: ACCAACGATACCCCAACGTC) exhibited the best characteristics with a length of 20 bp, Tm of 60.0–60.1°C, GC content of 45–55%, no secondary structure, and the ability to amplify 11 of 18 Treponema spp. genomes while failing to amplify any of the Neisseria spp. genomes tested. Bioinformatics analysis confirms that the tprK gene is a valid target for the detection of Treponema pallidum. Both designed primer pairs exhibited optimal technical characteristics and high specificity toward Treponema spp., thus showing potential for development as the basis for a more accurate molecular detection method for syphilis. However, further in vitro validation is required before clinical application. Keywords: Treponema Pallidum, Neisseria Gonorrhoeae, Bioinformatics, In Silico PCR, Sequence Analysis. ABSTRAK Infeksi Menular Seksual (IMS) masih menjadi masalah kesehatan masyarakat yang signifikan di Indonesia dan dunia, dengan sifilis dan gonore sebagai dua penyakit yang sering muncul bersamaan. Diagnosis dini sifilis sangat penting untuk mencegah komplikasi serius, namun pemeriksaan serologi untuk Treponema pallidum yang umum digunakan memiliki keterbatasan karena bersifat tidak spesifik. Pendekatan bioinformatika menawarkan solusi untuk mengembangkan metode deteksi molekuler yang lebih akurat melalui analisis genom dan desain primer berbasis komputer. Penelitian ini bertujuan untuk menganalisis secara bioinformatika gen tprK Treponema pallidum sebagai target deteksi molekuler serta merancang dan memvalidasi pasangan primer spesifik menggunakan pendekatan in silico PCR yang mampu membedakan T. pallidum dari Neisseria gonorrhoeae. Penelitian dilakukan dengan pendekatan bioinformatika melalui beberapa tahapan: ekstraksi dan analisis sekuen gen tprK dari basis data GenBank (AF343921.1), penerjemahan sekuen nukleotida menjadi protein menggunakan BioEdit, pemodelan struktur tiga dimensi protein TprK menggunakan SWISS-MODEL, desain dan seleksi pasangan primer menggunakan Primer3Plus dengan parameter 18-22 bp, Tm 55-60°C, dan GC 40-60%, analisis karakteristik primer menggunakan OligoCalc, serta uji spesifisitas melalui in silico PCR terhadap 18 genom Treponema spp. dan 18 genom Neisseria spp. Analisis bioinformatika menunjukkan gen tprK (1.461 bp) mengkode protein 486 asam amino dengan struktur 3-D stabil. Dari lima pasang primer kandidat yang didesain, Pair 4 (forward: ACCGGGAAGTAAATGGCTGG, reverse: ATGCCCCTACGAATTGCCAA) dan Pair 5 (forward: TTATGGGGCCTACCTGACCA, reverse: ACCAACGATACCCCAACGTC) memiliki karakteristik terbaik dengan panjang 20 bp, Tm 60,0-60,1°C, GC 45-55%, tanpa struktur sekunder, serta mampu mengamplifikasi 11 dari 18 genom Treponema spp. dan tidak mengamplifikasi seluruh genom Neisseria spp. yang diuji. Analisis bioinformatika membuktikan bahwa gen tprK merupakan target yang valid untuk deteksi Treponema pallidum. Kedua pasangan primer hasil desain menunjukkan karakteristik teknis yang optimal dan spesifisitas tinggi terhadap Treponema spp., sehingga berpotensi dikembangkan sebagai dasar metode deteksi molekuler sifilis yang lebih akurat. Namun demikian, diperlukan validasi in vitro lebih lanjut sebelum aplikasi klinis. Kata Kunci: Treponema Pallidum, Neisseria Gonorrhoeae, Bioinformatika, PCR In Silico, Analisis Sekuen.
PELATIHAN DAN SOSIALISASI PEMELIHARAAN BIBIT MANGROVE SEBAGAI UPAYA KONSERVASI BERKELANJUTAN DESA SUNGSANG IV, SUMATRA SELATAN Yuniar Harvianti; Muhammad Komarul Huda; Ayu Safitri; Syafrina Lamin; Dwi Puspa Indriani; Yadi Oktariansyah; Doni Setiawan; Sarno; Singgih Tri Wardana; Guntur Pragustiandi
SIMAS: Jurnal Pengabdian Masyarakat Vol. 4 No. 3 (2026): SIMAS: Jurnal Pengabdian Masyarakat, September 2026
Publisher : FTIK UIN Sultan Aji Muhammad Idris Samarinda

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21093/q1yasw62

Abstract

Ekosistem mangrove memiliki peran ekologis yang strategis sebagai pelindung kawasan pesisir dari abrasi, penyerap dan penyimpan karbon biru, serta penopang produktivitas sumber daya perikanan. Namun, keberlanjutan fungsi tersebut kerap terkendala oleh terbatasnya pengetahuan dan keterampilan masyarakat dalam menerapkan teknik pembibitan dan pemeliharaan bibit mangrove yang tepat. Berdasarkan permasalahan tersebut, kegiatan pelatihan dan sosialisasi pemeliharaan bibit mangrove di Desa Sungsang IV, Kabupaten Banyuasin, Sumatera Selatan, sebagai upaya nyata mendukung konservasi pesisir berkelanjutan sangat perlu dilakukan. Kegiatan ini bertujuan meningkatkan pemahaman masyarakat mengenai fungsi ekologis, ekonomi, dan sosial mangrove sekaligus membekali keterampilan praktis dalam pemilihan, penyemaian, dan perawatan bibit. Kegiatan dilaksanakan secara partisipatif dengan melibatkan masyarakat desa, kelompok nelayan, mahasiswa, dosen, dan perangkat desa, meliputi tahap sosialisasi, pelatihan teknis, demonstrasi lapangan, pendampingan, hingga evaluasi berbasis kuesioner pre-test dan post-test. Hasil kegiatan menunjukkan antusiasme dan keterlibatan masyarakat yang tinggi dalam proses penanaman dan pengelolaan awal arboretum. Berdasarkan hasil evaluasi, rata-rata tingkat pemahaman peserta meningkat dari 38,4% sebelum kegiatan menjadi 92,2% setelah kegiatan, dengan peningkatan rata-rata sebesar 53,8%. Hasil ini menunjukkan bahwa metode pelatihan dan sosialisasi yang digunakan mampu meningkatkan pengetahuan masyarakat secara signifikan. Peningkatan tertinggi ditemukan pada parameter pemahaman mengenai arboretum, yaitu sebesar 68,5%, diikuti oleh pemahaman manfaat arboretum sebesar 65,7% dan pemahaman langkah pelestarian bibit mangrove sebesar 60,0%. Kegiatan ini membuktikan bahwa pendekatan edukatif berbasis pelatihan dan sosialisasi efektif membangun kapasitas dan kesadaran masyarakat pesisir, sekaligus memperkuat komitmen kolektif dalam menjaga kelestarian ekosistem mangrove sebagai aset ekologis dan ekonomi jangka panjang bagi Desa Sungsang IV
Komunitas Vegetasi Tumbuhan Kolam Konservasi SPEECTRA Patra Tani Dea Ananda; Sevi Sawestri; Doni Setiawan
Seminar Nasional Lahan Suboptimal Vol 13, No 1 (2025): Prosiding Seminar Nasional Lahan Suboptimal ke-13 "Optimalisasi Lahan Suboptima
Publisher : Pusat Unggulan Riset Pengembangan Lahan Suboptimal (PUR-PLSO) Universitas Sriwijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Ananda, D., Sawestri, S., & Setiawan, D. (2025). Plant Vegetation Community of SPEECTRA Patra Tani Conservation Pond. In: Herlinda S et al. (Eds.), Prosiding Seminar Nasional Lahan Suboptimal ke-13 Tahun 2025, Palembangg 20 Oktober 2025. (pp. x–y). Palembang: Penerbit & Percetakan Universitas Sriwijaya (UNSRI).The SPEECTRA (Special Area for Conservation and Fish Refugia) pond is a fisheries management model designed to save local fish in flooded swamp waters. The SPEECTRA pond also has the potential to support various types of vegetation that play an important role in maintaining water quality and ecosystem balance. The purpose of this study was to determine the structure of the plant community in the SPEECTRA pond. The study was conducted in July 2025 in three SPEECTRA ponds at the SFV Patra Tani BRPPUPP Installation, Muara Enim. Plant collection was carried out using a 5 x 5 m2 quadrat method with two replicates at each station. The types of plants collected were identified, then analyzed for density, diversity index, and dominance index. There were three classes and ten types of plants found in the SPEECTRA ponds. The plant density in the SPEECTRA ponds ranged from 5.02 to 16 ind/m2. The diversity of plant species at the site showed moderate values (0.96-1.41). No plant species dominated, but the Liliopsida family and the Elaeocharis dulcis or purun tikus (0.33) species were frequently found at the study site. This plant species is often found in flooded swamp areas due to its ability to act as a biofilter in water and provide shelter for aquatic biota. The existence of plant communities in the SPEECTRA ponds is very important in supporting the availability of food sources and habitats for fish communities.
Co-Authors . Ajiman Alexandria Stephanie Suparman Ayu Safitri Dea Ananda Dwi Puspa Indriani Farida Isroani Guntur Pragustiandi Hilda Zulkifli Liesa Z Subuh Muhamad Fardan S Muhammad Abdul Hadi Rabbani Muhammad Hadi Sulhan Muhammad Komarul Huda Nabil Ridla Firdaus Revianti Coenraad Richard Noske Risfidian Mohadi Rivana Ariyadi Rochmanah Suhartati Sarno . Sevi Sawestri Singgih Tri Wardana Suparman, Alexandria Stephanie Syafrina Lamin, Syafrina Yadi Oktariansyah Yugos Juli Fitra Yuniar Harvianti