Article Per Year (5 Year)
p-Index From 2020 - 2025
0
P-Index
This Author published in this journals
All Journal Indonesian Journal of Biotechnology Jurnal Kedokteran Hewan
Charles Rangga Tabbu
Bagian Patologi Fakultas Kedokteran Hewan UGM Yogyakarta
Biochemistry, Genetics & Molecular Biology Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Veterinary

Published : 3 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 3 Documents
Search

 1 
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Wibowo, Michael Haryadi; Srihanto, Agus Eko; Putri, Khrisdiana; Asmara, Widya; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB)

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid.Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
ISOLASI DAN IDENTIFIKASI VIRUS AVIAN INFLUENZA PADA BERBAGAI SPESIES UNGGAS SECARA SEROLOGIS DAN MOLEKULER (Isolation and Identification of Avian Influenza in Different Species of Poultry by Means of Serological and Molecular Methods) Helmi, Teuku Zahrial; Tabbu, Charles Rangga; Artama, Wayan Tunas; Haryanto, Aris; Isa, Muhammad
Jurnal Kedokteran Hewan Vol 10, No 1 (2016): March
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v10i1.3378

Abstract

The purpose of this research was to identify avian influenza (AI) virus using serological and molecular methods on poultry which suspected as AI infected in Aceh province. This study used 37 samples of tracheal and cloacal swabs and organs from various species of poultry that were collected from several districts/cities in Aceh. Samples were collected and put into transport media and stored at 4 C before sending to the laboratory. Samples were inoculated in specific pathogen-free of embryonated chicken egg with the age of 9-11 days for further serological and molecular examination. From 37 samples which infected to embryonated chicken egg then followed by hemagglutinin agglutination test/hemagglutinin inhibition revealed that 7 samples were positively infected with AI virus. The amplification result of specific matrix gene primer was followed by electrophoresis on 2% agarose gel which were obtained in the form of a deoxyribonucleic acid (DNA) band at 276 bp for matrix gene and 1.725 bp for H5 gene for all isolates test. In conclusion, the virus which caused the death of various types of poultry in Aceh province is avian influenza A virus subtype H5.Key words: avian influenza virus, H5N1, serologic, matrix, heamaglutinin
Co-Authors Agus Eko Srihanto, Agus Eko Aris Haryanto Haryadi M. Wibowo, Haryadi M. Heru Susetya Khrisdiana Putri, Khrisdiana Michael Haryadi Wibowo Muhammad Isa Teuku Zahrial Helmi Tri Untari Wayan Tunas Artama Widya Asmara