Claim Missing Document
Check
Articles

Found 12 Documents
Search

The use of earthworm meal (Lumbricus rubellus) as anti-pullorum agent in feed additive of broiler chicken Damayanti, Ema; Sofyan, Ahmad; Julendra, Hardi; Untari, Tri
Indonesian Journal of Animal and Veterinary Sciences Vol 14, No 2 (2009)
Publisher : Indonesian Animal Sciences Society

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (114.826 KB) | DOI: 10.14334/jitv.v14i2.348

Abstract

The aim of this research was to study the use of earthworm meal (TCT) L. rubellus as anti pullorum agent in poultry feed additive (IP). The antibacterial activity of TCT against Salmonella pullorum was examined using diffusion agar method at each of the following concentrations: 0, 25, 50, 75 and 100% (w/v) in 100 µL DMSO. In vivo test was conducted using 80 broiler chicken and were infected by S. pullorum with treatments of: IP0: IP contained 0% TCT, IP1: IP contained 25% TCT, IP2: IP contained 50% TCT, IP3: IP contained 75% TCT and IP4: IP contained 100% TCT. Each treatment was replicated 4 times with 4 chicks each. Feed additive was periodically fed to broiler during 7 days before and 10 days after infection. Anti-pullorum activities were evaluated using serology test, isolation and biochemical identification of S. pullorum. The results showed that 75% TCT was optimum to inhibit S. pullorum in vitro. The isolation and identification of S. pullorum results showed that 0 out of 8 (0%) broilers treated with IP4 was not infected by S. pullorum whereas 1 out of 2 (50%) broilers treated with IP0 were infected by S. pullorum. The reduction of S. pullorum prevalence as followed by increasing TCT in feed additive. In conclusion, TCT as poultry feed additive could inhibit S. pullorum infection. Key words: Earthworm Meal, Feed Additive, S. Pullorum
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
Prevalensi dan Analisis Faktor Risiko Multidrug Resistance Bakteri Escherichia coli pada Ayam Komersial di Kabupaten Blitar Wibisono, Freshinta Jellia; Sumiarto, Bambang; Untari, Tri; Effendi, Mustofa Helmi; Permatasari, Dian Ayu; Witaningrum, Adiana Mutamsari
Jurnal Ilmu Peternakan dan Veteriner Tropis (Journal of Tropical Animal and Veterinary Science) Vol 10 No 1 (2020): Jurnal Ilmu Peternakan dan Veteriner Tropis (Journal of Tropical Animal and Vete
Publisher : Fakultas Peternakan Universitas Papua

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (439.328 KB) | DOI: 10.46549/jipvet.v10i1.74

Abstract

Multidrug resistance is a problem that is difficult to overcome in terms of treating infectious diseases. Multidrug resistance is the term used to describe when a bacteria is resistant to three or more different classes of antibiotics. Escherichia coli as a commensal bacterium which has multidrug resistance, this causes more issues because Escherichia coli can transfer its resistant properties to other bacteria within the poultry digestive tract. The observational study is used to determine the risk factors and to estimate the quantitative effects arising from various components that contribute to the emergence of a disease. The sampling in this study was carried out randomly through cloaca swabs from commercial chicken farms in Blitar and 345 samples were collected. Complementary data collection was carried out using questionnaires, interviews, and field observations. The results showed the incidence of multidrug resistance in commercial chickens in the Blitar District was 72.5%. There is a relationship between causative factors with the incidence of multidrug resistance in Escherichia coli bacteria that is significantly associated with positive risk factors. The strength of this relationship can be seen from the value of OR and RR, among others factors of chicken breed (OR = 3.07; RR = 1.34), breeder's education (OR = 2.3; RR = 1.29), type of livestock business (OR = 7.5; RR = 1.43), type of animal feed (OR = 1.91; RR = 1.2), veterinary support for livestock raising management (OR = 3.09; RR = 1.44). The reference variables are whether the antibiotics are administered by non-veterinarians (OR = 2.35) or by the TS (OR = 7.92), and whether there is an antibiotic administration program (OR = 3.16; RR = 1.47). The overseeing function of farm maintenance, management, and implementation of antimicrobial administration in commercial chicken farms needs to be improved, to increase breeders' awareness of the careful usage of antibiotics and controlling the incidence of antibiotic resistance.
Change of Soil Biomass Carbon Microorganism in Ultisols Soil Due to Application of Humic Acid and TSP Fertilization Buchari, Henrie; Untari, Tri; Niswati, Ainin; Sunyoto, Sunyoto
JOURNAL OF TROPICAL SOILS Vol. 26 No. 3: September 2021
Publisher : UNIVERSITY OF LAMPUNG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.5400/jts.2021.v26i3.149-156

Abstract

Soil biomass carbon microorganism (C-mic) is one indicator of soil fertility. The application of humic acid, vermicompost aqueous extract, and TSP fertilization applied to the soil will affect the activity of soil microorganisms. This research aimed to study the effect of humic acid, vermicompost extract, and TSP fertilization on C-mic. The first factor was the application of humic acid (h), namely, without humic acid, commercial origin, and humic acid-like from watery extract vermicompost. The second factor is TSP fertilization (p) divided into four dose levels: without TSP fertilizer, TSP fertilizer 100 kg ha-1, TSP fertilizer 200 kg ha-1, and TSP fertilizer 300 kg ha-1. Data were analyzed by analysis of variance and continued with the Least Significant Difference (LSD) test at the 5% significance level. The correlation between C-organic, soil pH, soil temperature, soil moisture content, stalk dry weight, and weight of corn kernels with C-mic was tested by correlation test. The results showed that the application of humic acid and TSP fertilization had no significant effect on C-mic, and there was no interaction between the two at seven days after planting (DAP), 56 DAP, and 104 DAP. There was a correlation between soil organic carbon 7 DAP (r: 0.34*), 56 DAP (r: 0.59*), and 104 DAP (r: 0.53*), soil moisture content at 7 DAP (r: 0.36*), soil pH at 56 DAP (r: 0.42*) and 104 DAP (r: 0.43*), soil temperature at 104 DAP (r: -0.52*), stalk dry weight at 56 DAP (r: 0.34*), corn kernels weight at 113 DAP (r: 0.65*) with C-mic.
Detection of Newcastle Disease, Avian Influenza, dan Infectious Bronchitis Virus from Commercial with Respiratory Clinical Signs Santoso, Ferdinand Prayogo Cahyo; Wahyuni, Agnesia Endang Tri Hastuti; Untari, Tri; Asmara, Widya; Wibowo, Michael Haryadi
Jurnal Sain Veteriner Vol 43, No 2 (2025): Agustus
Publisher : Faculty of Veterinary Medicine, Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.93221

Abstract

Clinical symptoms in the chicken’s respiratory system, such as sores, nasal discharge, gasping, and so on, can be caused by a variety of possible socks. These signs may be caused by a virus, usually followed by economic losses. Causative diagnosis, especially virus detection, is needed to establish the cause of the symptoms. The study aims to detect Newcastle Disease (ND), Avian Influenza (AI), and Infectious Bronchitis (IB) cases of respiratory symptoms in commercial chickens by 2023. The samples studied in this study were organs from commercial chicken broilers and layers with respiratory symptoms. The organ was prepared as a suspension, then centrifuged to take out the supernatants. Supernatants were extracted using commercial extraction kits to produce templates for molecular detection. Molecular detection was performed using the RT-PCR two-step method. Primer pairs were used for the detection of ND, AI subtypes H5 and H9, as well as IB. The results were visualized by electrophoresis with 1.5% agarose. Interpretation of the positive result of RT-PCR based on the appearance and length of amplicons compared with the positive control of each virus. Positive RT-PCR samples with thick amplicon quality were subjected to sequencing and bioinformatics analysis. Results of detection with RT-PCR against 41 samples are positive ND of 1 out of 8 samples (12.5%), AI of 2 out of 17 samples (11.7%), and IB of 5 out of 16 samples (31.3%). Based on the molecular detection with RT-PCR, the symptoms of respiration in commercial chickens are confirmed due to the cause, namely the virus: ND genotype VII-i, AI subtype H5 clade 2.3.2, AI subtype H9, and IB genotype GI-19 (QX-like).
Pathological Investigation of Lumpy Skin Disease in Cattle from Sleman, Indonesia Kristianingrum, Yuli Purwandari; Winarsih, Sugi; Sutrisno, Bambang; Widyarini, Sitarina; Sugiyono, Sugiyono; Untari, Tri
Jurnal Medik Veteriner Vol. 8 No. 2 (2025): October
Publisher : Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jmv.vol8.iss2.2025.414-423

Abstract

In early 2023, there was an outbreak of lumpy skin disease (LSD) in cattle in Indonesia, with particularly high prevalence in Sleman, Special Region of Yogyakarta, Indonesia. Since then, cases of this disease have been increasing, causing significant economic losses to cattle and buffalo farmers. This study aimed to investigate the pathological changes caused by LSD virus infection in various organs of Sleman cattle. We investigated 15 animals from 10 farms. Skin samples were taken by biopsy. ELISA testing was performed on serum samples. We also performed necropsies on two LSD infected cow carcasses to observe the macroscopic and microscopic effects of the virus. During the necropsies, samples were obtained from skin nodules, skeletal muscle, and internal organs (lung, liver, kidney, lymphatic nodes, spleen, and digestive organs). These were subjected to histopathological examination using hematoxylin and eosin staining. Among the live animals, fever, lethargy, hypersalivation, and lacrimation were the most common clinical signs. Our qualitative descriptive analysis of the pathological changes, clinical signs, and ELISA results showed that LSD infection in cattle causes mild to severe damage to various organs. Our macroscopic examinations found that affected animals had skin nodules of varying sizes over the entire body. We observed mild to severe inflammation and hemorrhage in the internal organs, including the skeletal muscles, spleen, liver, heart, rumen, reticulum, abomasum, and small intestine. Based on this investigation, we conclude that, in addition to its effects on the skin, LSD causes pathological changes in various internal organs.
Impact of Spirulina platensis Extract as an Immunostimulant on the Histopathological Intestinal of Tilapia Fish (Oreochromis niloticus) Infected with Aeromonas salmonicida Ramadhan, Maharani Kartika; Kurniasih; Untari, Tri; Fadholly, Amaq
Jurnal Veteriner dan Biomedis Vol. 3 No. 2 (2025): September
Publisher : Sekolah Kedokteran Hewan dan Biomedis

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jvetbiomed.3.2.%p.

Abstract

Furunculosis in fish results in financial detriment to freshwater aquaculture in Indonesia. Furunculosis, an infectious disease produced by Aeromonas salmonicida, presents a considerable risk to the large-scale farming of both salmonid and non-salmonid species in freshwater environments. This study sought to evaluate the impact of Spirulina platensis extract on the histopatological intestinal health of tilapia infected with Aeromonas salmonicida. Thirty tilapia, each around 10 cm in length, were distributed into five groups. Negative control (P0-) without immersion in Spirulina platensis extract and free from Aeromonas salmonicida infection. Positive control (P0 +) not immersed in Spirulina platensis extract, infected with Aeromonas salmonicida. Tilapia subjected to doses of 400 mg/L (P1), 600 mg/L (P2), and 800 mg/L (P3) The extraction of Spirulina platensis occurred for three hours on the seventh day (first immersion) and the fourteenth day (second immersion), followed by an evaluation of Aeromonas salmonicida infection on the twenty-first day. A necropsy of the fish was performed on day 28. Histopathological analysis revealed that Spirulina platensis extract reduced intestinal villous erosion and inflammatory cell density in the intestines of tilapia. Immunohistochemical staining demonstrated a decrease in the presence of Aeromonas salmonicida within intestinal tissue at a dosage of 800 mg/L. This work indicates that more research is necessary to examine the histological features of the intestines of tilapia infected with Aeromonas salmonicida with those supplemented with Spirulina platensis through feed.
EVALUASI KIT DETEKSI CEPAT TERHADAP SAMPEL OTAK ANJING TERINFEKSI VIRUS RABIES Wibowo, Michael Haryadi; Untari, Tri; Artanto, Sidna; Amanu, Surya; Wahyuni, AETH.; Asmara, Widya
Jurnal Kedokteran Hewan Vol 9, No 1 (2015): March
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v9i1.2797

Abstract

Penelitian ini bertujuan mengetahui potensi kit deteksi cepat Anigen rapid test kit rabies Ag dalam mendeteksi virus rabies pada sampel otakanjing yang diperoleh dari lapangan yang meliputi batas deteksi, kecepatan reaksi, uji reaksi silang, uji sensitivitas, dan spesifisitas. Batas deteksi ditentukan dengan pengenceran secara serial kontrol positif virus rabies dan selanjutnya diuji dengan rapid test kit sesuai petunjuk produsen. Uji reaksi silang dilakukan dengan canine parvovirus, Escherichia coli, dan Salmonella sp. Uji sensitivitas dan spesifisitas dilakukan terhadap sampel otak yang telah dikonfirmasi positif rabies dengan uji fluorescent antibody technique. Konfirmasi uji rapid test tersebut dilakukan dengan reverse transcriptase polymerase chain reaction. Berdasarkan data yang diperoleh dalam penelitian ini dapat disimpulkan bahwa Anigen rapid test kit rabies Ag mampu mendeteksi sampel yang mengandung virus rabies dengan titer 0,5 x log 106,5/0,03 ml, dengan rata-rata kecepatan reaksi 1,8 menit 29,35 detik (kurang dari 2 menit). Di samping itu Anigen rapid test kit rabies menunjukkan tidak terdapat reaksi silang dengan canine parvovirus, Escherichia coli, dan Salmonella sp. serta mempunyai sensitivitas 92,30% dan spesifisitas 97,90%
EFEKTIVITAS ENROFLOKSASIN TERHADAP INFEKSI BAKTERI PADA SALURAN PENCERNAAN ULAR SANCA BATIK (Python reticulatus) Wijayanti, Agustina Dwi; Untari, Tri; Rosetyadewi, Antasiswa W.; Rahardjo, Slamet
Jurnal Kedokteran Hewan Vol 7, No 2 (2013): September
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v7i2.898

Abstract

Penelitian ini bertujuan mengetahui efektivitas enrofloksasin terhadap infeksi bakteri pada saluran pencernaan ular sanca batik (Python reticulatus). Ular yang digunakan berjumlah 10 ekor dan terindikasi klinis mengalami gangguan pencernaan berupa keradangan pada mulut. Sampel yang diambil adalah swab mulut dan kloaka untuk pemeriksaan mikrobiologi berupa isolasi dan identifikasi bakteri pada media brilliant green agar, Mc Conkay agar, triple sugar iron, dan pembiakan isolat murni. Setelah pengambilan sampel semua ular diinjeksi dengan enrofloksasin 5 mg/kg bobot badan, dosis tunggal secara intramuskular anterior. Pengamatan klinis dilakukan hingga semua ular dinyatakan sembuh dari keradangan mulut. Hasil pemeriksaan mikrobiologi menunjukkan adanya bakteri Salmonella sp., E. coli, dan Proteus sp. pada saluran pencernaan ular. Enrofloksasin yang diberikan secara injeksi intramuskular anterior mampu memberikan kesembuhan dalam rentang waktu 4-16 hari setelah pemberian.
Effect of Puzzle Games on Fine Motor Development In Children Aged 4-5 Years Untari, Tri; Chunaeni, Siti; Marsini, Marsini
Midwifery and Nursing Research Vol. 7 No. 2 (2025): SEPTEMBER 2025
Publisher : Poltekkes Kemenkes Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31983/manr.v7i2.12924

Abstract

ABSTRACT  Background: The quality of a child's future is based on optimal child growth and development, so identification, stimulation and intervention for various growth or developmental disorders must be carried out from an early age. During the middle and late childhood periods, children's motor development becomes more refined and coordinated. Children gain more control over their bodies. The increase in myelin of the central nervous system is reflected in the improvement of fine motor skills. Increased fine motor development is reflected in handwriting skillsMethods: District The research method used is the type of research Quasy Experiment with one Group Pretest-Postest Design.Total sampling technique . The number of samples in this study was 30 respondentsResults: The results of the research of all 30 students experienced an increase in writing learning outcomes with an average increase of 15.50 and a positive ranking of 465.00 similarities in pre-test and post-test results. Here the Ties value is 0, Because the value of 0.000 is less than < 0.05Conclusion: it can be concluded that "Ha accepted" means that there is a difference between the pre-test and post-test written results, and the puzzle used . The p value for fine motor hand skills is 0.046, then the fine motor value of speed is 0.000, and the fine motor value of precision is 0.000. Because from the results of fine motor skills of hand skills, speed, and accuracy of values (p value ≤ 0.05), it can be concluded that there is an influence of puzzle games on the development of fine motor skills of children aged 4 – 5 years at Raudhatul Athfal Bligo 1 Kindergarten. Ngluwar District. Children's fine motor development has improved after being given a puzzle game, it is hoped that it can be used as input in adding insight and information about fine motor development in children aged 4-5 years