Article Per Year (5 Year)
p-Index From 2020 - 2025
0.61
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Indonesian Journal of Tropical and Infectious Disease Indonesian Journal of Biotechnology The International Journal of Tropical Veterinary and Biomedical Research
Khrisdiana Putri, Khrisdiana
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Earth & Planetary Sciences Health Professions Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Public Health Veterinary

Published : 5 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 5 Documents
Search

 1 
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Wibowo, Michael Haryadi; Srihanto, Agus Eko; Putri, Khrisdiana; Asmara, Widya; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB)

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid.Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
Molecular Characterization of Infectious Bursal Diseases Virus VP2 Gene Fragments Obtained from Commercial Broiler Farms in Central Java and The Yogyakarta Special Region Province Damairia, Bernike Anggun; Putri, Khrisdiana; Wibowo, Michael Haryadi
HAYATI Journal of Biosciences Vol. 31 No. 6 (2024): November 2024
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.31.6.1201-1211

Abstract

Infectious Bursal Disease (IBD) is an infectious and immunosuppressive disease primarily affecting young chickens. Despite stringent biosecurity and vaccination for control measures, the effective management of IBD remains challenging. The disparity in observed clinical symptoms in the field infections further complicates matters for breeders. The study aims to perform molecular characterization of VP2 gene fragments to identify the latest genotype of field IBD viruses. Twenty-two samples of bursa of Fabricius were collected from broilers suspected of IBD in commercial farms located in Central Java and The Yogyakarta Special Region from 2021 to 2022. Viral RNA was extracted from these samples, and after amplification, a 743 bp PCR product was obtained and subjected to sequencing. The obtained sequences were analyzed in Mega X for multiple alignments, amino acid prediction, homology, and phylogenetic tree construction. Lesion, i.e., Bursa of Fabricius enlargement, oedema, swelling of plica bursa, gelatinous mass, hemorrhage, atrophy, and thigh muscles petechiae to hemorrhage, were considered indicative of IBD. Out of 22 samples tested by RT-PCR, 19 were positive, and 13 samples were selected for sequencing. All sequenced samples belonged to Genogroup A3, specifically the very virulent IBD (vvIBD) strain.
Antibiotic-Resistant Genes and Polymorphisms of blaTEM1 gene in Multidrug-resistant Escherichia coli from Chicken Eggs and Cloacal Swabs in Sleman, Yogyakarta: The Impact on Public Health Nastiti, Niken Irfa; Asmara, Widya; Putri, Khrisdiana
Indonesian Journal of Tropical and Infectious Disease Vol. 12 No. 3 (2024)
Publisher : Institute of Topical Disease Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/ijtid.v12i3.49885

Abstract

Antimicrobial resistance in pathogenic bacteria is a serious problem in public health. Antibiotic-resistant pathogens are the cause of many deaths.  Escherichia coli (E. coli) is one of the bacteria that experienced multi-drug resistance (MDR). Infection of Escherichia coli in humans occurs through transmission of fecal-oral. This study, conducted at the Veterinary Public Health Laboratory of Gadjah Mada University, aimed to assess MDR E. coli prevalence in 200 chicken egg samples sourced from poultry farms and supermarkets, alongside 63 cloacal swab samples from broiler poultry in Sleman, Yogyakarta. The study focused on detecting resistance genes including tetA, aadA1, aph(3)IIa, and blaTEM1, also analyzing polymorphisms in the blaTEM1 gene associated with antibiotic resistance. Identification technique of E. coli positivity refers to the Indonesian National Standard (SNI) 2897:2008, then E. coli identification was performed using the Analytical Profile Index (API) Test 20E Kit. Antibiotic sensitivity was determined by the Kirby Bauer method. Detection of antibiotic resistance genes in E. coli were determine using Polymerase Chain Reaction (PCR) method. Sequencing and analysis of polymorphism and phylogenetic were performed only in blaTEM1. There were 12 samples identified as having E. coli (1 from chicken eggs and 11 from cloacal swabs), resistance percentages were highest for erythromycin (100%), ampicillin (91.7%), ciprofloxacin (91.7%), sulfamethoxazole (83.3%), streptomycin (83.3%) gentamicin (75%), tetracycline (41.7%), and chloramphenicol (25%). respectively. All of 12 E. coli samples were bacteria with MDR. Resistant genes were prevalent, notably blaTEM1 and aadA1 (100% each), with aph(3)IIa and tetA genes also detected in 58.3% of samples each. Sequencing of the blaTEM1 gene revealed polymorphisms in isolate A8. However, these did not alter its antibiotic resistance phenotype. Sequences of E. coli isolates showed similarities to strains from Vietnam, China, and India, countries with high antibiotic consumption, particularly ampicillin.
Antibiotic resistance in Escherichia coli from livestock-related sources: A cross-sectional study of feces, soil, and water in a non-urban region Silalahi, Gustaf Eifel; Widiasih, Dyah Ayu; Susetya, Heru; Nugroho, Widagdo Sri; Drastini, Yatri; Putri, Khrisdiana; Gallantiswara, Putu Cri Devischa; Yudhanto, Setyo; Primatika, Roza Azizah
The International Journal of Tropical Veterinary and Biomedical Research Vol 10, No 1 (2025): Vol 10 (1) May 2025
Publisher : The Faculty of Veterinary Medicine of Syiah Kuala University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/ijtvbr.v10i1.46238

Abstract

Background and Aim: Antibiotics are one of the most used treatments by farmers, both in commercial and non-commercial livestock operations. The use of antibiotics in animals directly impacts the environment, which can become a significant factor in the spread of antibiotic resistance. The environment plays an essential role for both animals and humans, and contamination caused by uncontrolled environmental factors can lead to health impacts on surrounding populations. One of the contaminants that can threaten the health of animals and humans is the presence of Escherichia coli. The aim of this study was to determine the antibiotic resistance profile of E. coli in environmental samples collected from a non-urban livestock region in Playen, Gunung Kidul Regency, Yogyakarta.Materials and Methods: The data in this study consisted of fifty samples, including fishpond water, wastewater, drinking water, water source, water tank, feces, and soil. The methodology involved bacterial isolation using biochemical tests and antimicrobial resistance testing conducted through the KirbyBauer disk diffusion method.Results: The antibiotics used in this study were streptomycin, penicillin, enrofloxacin, oxytetracycline, and sulfamethoxazole. The results showed that 5% of the samples were resistant to streptomycin, 92% were resistant to penicillin, 0% were resistant to enrofloxacin, 12.8% were resistant to oxytetracycline, and 2.5% were resistant to sulfamethoxazole.Conclusion: The findings indicate a high prevalence of Penicillin-resistant E. coli in environmental samples from non-urban livestock areas, highlighting the potential risk of environmental antibiotic resistance transmission.
Co-Authors Agus Eko Srihanto, Agus Eko Charles Rangga Tabbu Damairia, Bernike Anggun Dyah Ayu Widiasih Gallantiswara, Putu Cri Devischa Haryadi M. Wibowo, Haryadi M. Heru Susetya Michael Haryadi Wibowo Niken Irfa Nastiti Roza Azizah Primatika, Roza Azizah Silalahi, Gustaf Eifel Tri Untari Widagdo Sri Nugroho Widya Asmara Yatri Drastini Yudhanto, Setyo