Garuda - Garba Rujukan Digital

Article Per Year (5 Year)

All

VALENSI

valensi
Website

Published by Universitas Islam Negeri Syarif Hidayatullah Jakarta

ISSN : 24606065 EISSN : 25483013 DOI : 10.15408/jkv

Core Subject : Science,

Chemistry

Jurnal Kimia Valensi is a biannual and peer-reviewed open access journal published by Department of Chemistry, Faculty of Science and Technology UIN Syarif Hidayatullah Jakarta. This journal covering all aspect of chemistry.

Arjuna Subject : Umum - Umum

Articles 425 Documents

16 17 18 19 20

Asam Protokatekuat dari Ekstrak Etil Asetatbiji Honje (Etlingera elatior) dan Uji Aktivitas Antioksidannya Dede Sukandar; Ibnu Umarudin Umedi; Siti Nurbayti; Tarso Rudiana; Ahmad Fathoni
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 4, No. 1, Mei 2018
Publisher : Syarif Hidayatullah State Islamic University

Telah dilakukan penelitian untuk mengetahui struktur senyawa fenolik yang memiliki aktivitas antioksidan dari ekstrak etil asetat biji honje (E. elatior). Isolasi senyawa fenolik dilakukan dengan metode maserasi, fraksinasi dengan kromatografi kolom gravitasi (KKG), dan kromatografi lapis tipis (KLT). Uji aktivitas antioksidan menggunakan metode DPPH (2,2-diphenyl-1-picrylhydrazyl) dan penentuan struktur senyawa menggunakan spektroskopi UV-Vis, FTIR, NMR, dan MS. Isolat yang diperoleh berupa gum kuning sebanyak 18 mg dari 3 kg sampel kering. Hasil uji aktivitas antioksidan menunjukkan isolat dari ekstrak etil asetat memiliki aktivitas yang sangat kuat dengan IC50 1,32 µg/mL. Hasil analisis dengan spektroskopi UV-Vis, FTIR, NMR, dan MS menunjukkan isolat sesuai dengan rumus molekul C7H6O4 yang dikenal dengan asam protokatekuat (asam 3,4-dihidroksi benzoat).DOI:http://dx.doi.org/10.15408/jkv.v4i1.7225

Turunan Senyawa Flavonoid dari Daun Macaranga involucrata (Roxb.) Baill dari Buton Tengah, Sulawesi Tenggara Edi Ilimu; Yana Maolana Syah
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 5, No. 1, May 2019
Publisher : Syarif Hidayatullah State Islamic University

Macaranga merupakan salah satu genus terbesar dari famili Euphorbiaceae yang terdiri dari 300 spesies dengan nama lokal mahang-mahangan. Tumbuhan Macaranga tersebar luas di wilayah Afrika dan Madagaskar di bagian barat hingga ke wilayah tropis Asia, Australia utara dan kepulauan Pasifik. Di Indonesia tumbuhan Macaranga tersebar di beberapa daerah yaitu daerah Papua, Maluku, Sulawesi, Kalimantan, Sumatera, Bangka, dan Jawa. Kajian fitokimia beberapa spesies Macaranga menunjukan adanya kelompok senyawa fenolik yaitu turunan flavonoid dan stilben, serta turunan terpenoid. Senyawa turunan fenolik tersebut memiliki keunikan dari struktur molekulnya, yaitu adanya subtituen tambahan dari metabolit terpenoid yaitu prenil (C5), geranil (C10), farnesil (C15), dan geranilgeranil (C20). Pada penelitian ini telah dilakukan isolasi metabolit sekunder dari daun M. involucrata (Roxb.) Baill dengan metode maserasi menggunakan pelarut aseton, kemudian dilanjutkan pemisahan dan pemurnian dengan menggunakan kromatografi cair vakum dan kromatografi radial untuk mendapatkan senyawa murni. Penentuan struktur dilakukan berdasarkan analisis data spektrum NMR 1D (1H-NMR dan13C-NMR), NMR 2D (NOESY, TOCSY, HSQC, dan HMBC), dan spektrum massa (MS). Berdasarkan metodologi tersebut, dua senyawa turunan flavon yaitu 5,7,4’-trihidroksi-3’(3-metilbut-2-enil)-3-metoksiflavon (1) dan makarangin (2), telah berhasil diisolasi dari tumbuhan ini. Berdasarkan hasil penelitian tersebut menunjukan daun M. involucrata (Roxb.) Baill yang berasal dari Kabupaten Buton Tengah, Sulawesi Tenggara menghasilkan senyawa fenolik turunan flavonoid. Kata kunci: Euphorbiaceae, Macaranga involucrata (Roxb.) Baill, flavon. Macaranga is one of the largest genera of the family Euphorbiaceae comprising 300 species with local name “mahang-mahangan”. Macaranga is widespread in the region of Africa and the west of Madagascar to the tropical regions of Asia, northern Australia, and the Pacific islands. In Indonesia Macaranga spread in several areas: Papua, Maluku, Sulawesi, Kalimantan, Sumatra, Bangka, and Java. Phytochemical studies showed the presence of several phenolic compounds such as flavonoids and stilbene derivatives. The phenolic compounds have a unique molecular structure with the addition of some substituents such as prenyl (C5), geranyl (C10), farnesyl (C15), and geranylgeranyl (C20). This research has been conducted on the isolation of secondary metabolites from the leaves of M. involucrata (Roxb.) Baill by maceration method using acetone, followed by separation and purification by using liquid vacuum chromatography and radial chromatography to obtain pure compounds. Determination of the structure is based on data analysis of 1D NMR spectrum (1H-NMR and 13C-NMR), 2D NMR (1H-1HCOSY, NOESY, TOCSY, HSQC, and HMBC), and mass spectra (MS). Based on this methodology, two flavone derivatives 5,7,4'-trihydroxy-3'(3-methylbut-2-enyl)-3-methoxy flavone (1) and macarangin (2), have been isolated from this plant. Based on these results showed that leaf of M. involucrata (Roxb.) Baill from Central Buton, Southeast Sulawesi produces phenolic compounds from flavonoid derivatives. Keywords: Euphorbiaceae, Macaranga involucrata (Roxb.) Baill, flavone.

Elusidasi Struktur Kimia Senyawa Bioaktif Pengendali Serangga Ulat Kubis Dari Kulit Batang Aglaia Disoxylum (Meliaceae) Dede Sukandar; Sofnie M Chairul; Nurlaela Nurlaela
Jurnal Kimia Valensi Jurnal Valensi VOLUME 1, NO.1, NOVEMBER 2007
Publisher : Syarif Hidayatullah State Islamic University

Telah dilakukan penelitian elusidasi struktur kimia senyawa fenol-2-(1-metiletoksi)-metilkarbamat, yang bersifat bioaktif (LC50 = 3,57 ppm) pengendali serangga ulat kubis(Crocidolomia binotalis Zeller) dari ekstrak etil asetat kulit batang Aglaia disoxylum(Meliaceae), salah satu tumbuhan yang dikenal sebagai pasak bumis. Senyawa inidiperoleh berupa kristal tidak berwarna, berbentuk jarum (40 mg), titik leleh 99–101 oC,rumus molekul C11H15NO3 dan BM = 209. Penetapan struktur kimia senyawa tersebutdilakukan berdasarkan data spektroskopi UV-VIS, FTIR, 1H dan 13C NMR, HMQC,HMBC, dan MS (GC-MS).

Pengaruh Penambahan Montmorillonit terhadap Interaksi Fisik dan Laju Transmisi Uap Air Komposit Edible Film Xanthan Gum-Montmorillonit Widya Tri Septi Saputri; Irwan Nugraha
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 3, No. 2, November 2017
Publisher : Syarif Hidayatullah State Islamic University

Telah dilakukan penelitian tentang pengaruh penambahan montmorilonit terhadap interaksi fisik dan laju transmisi uap air komposit edible film xanthan gum-montmorillonit. Penelitian ini diawali dengan preparasi montmorillonit dilanjutkan dengan sintesis komposit edible film xanthan gum-montmorillonit kemudian karakterisasi untuk lajutransmisi uap airkomposit edible film xanthan gum-montmorillonit dengan WVTR, XRD untuk mengetahui jenis kristalin,mengetahui gugus fungsi kompositedible film xanthan gum-montmorillonit dengan FTIR dan TEM untuk mengetahui interaksi antara xanthan gum dengan montmorillonityang terjadi di dalamkompositedible film xanthan gum-montmorillonit.Metode pencetakan yang digunakan adalah solvent casting.Hasil penelitian menunjukkan bahwa penambahan montmorillonit dapat menurunkan nilai laju transmisi uap air (WVTR) edible filmketika konsentrasi montmorillonit 2%, yaitu 15.3469 g/jam m2. Komposit edible film xanthan gum montmorillonit merupakan material amorf (non kristalin) yang mengalami interaksi fisik yang tidak signifikan akibat dari penambahan montmorillonit dalam jumlah kecil. Interaksi komposit edible film xanthan gum-montmorillonit yang terbentuk merupakan akibat dari proses eksfoliasi dan interkalasi. A study has been conducted on the effect of addition of montmorillonite to the chemical interaction and transmission rate of water vaporcomposite edible film xanthan gum-montmorillonite. This study begins with montmorillonite preparation followed by synthesis of edible film xanthan gum-montmorillonite and then characterization transmission rate of water vaporusing WVTR, XRD to know the crystalline type, knowing the composite edible film xanthan gum-montmorillonite functional groups with FTIR and TEM to determine the interaction between xanthan gum and montmorillonite occurring in the edible film xanthan gum-montmorillonite. The printing method which is used assolvent casting. The results showed that the addition of montmorillonite could decrease the value of the water vapor transmission rate (WVTR) edible film when the montmorillonite concentration was 2%, that is15.3469 g / hr m2. The edible film xanthan gum-montmorilloniteis an amorphous material (noncrystalline) experienced a significant insignificant physical interaction from the addition of montmorillonite in small amounts. Interaction of composite edible film xanthan gum-montmorillonite formed by exfoliation and intercalation.

Karakterisasi Senyawa Aktif Antioksidan dan Antibakteri Dalam Ekstrak Etanol Buah Namnam (Cynometra cauliflora L.) Dede Sukandar; Eka Rizki Amelia
Jurnal Kimia Valensi Jurnal Valensi Volume 3, No.1, Mei 2013
Publisher : Syarif Hidayatullah State Islamic University

Telah dilaporkan penelitian untuk mengetahui senyawa yang memiliki aktivitas antioksidan dan antibakteri dalam ekstrak etanol buah namnam (C. cauliflora L.) menggunakan instrumen GC-MS. Hasil analisa GC-MS menunjukkan adanya senyawa 5-hiroksimetilfurfural sebagai komponen utama dalam ekstrak etanol buah namnam. Ekstrak etanol buah namnam memiliki aktivitas antioksidan dengan nilai IC50 sebesar 328,29 ppm dan memiliki aktivitas antibakteri terhadap E. coli dan S. aureus dengan zona hambat masing-masing 16 mm pada konsentrasi 20%. Kata kunci: uji fitokimia, antioksidan, antibakteri, C. cauliflora L., DPPH dan difusi cakram

Pembuatan Kertas Indikator Asam Basa dari Bunga Kembang Sepatu (Hibiscus rosa-sinensis L.) Yusraini DIS
Jurnal Kimia Valensi Jurnal Valensi Volume 1, No.5, November 2009
Publisher : Syarif Hidayatullah State Islamic University

Sintesis dan Karakterisasi Nanopartikel Perak-Tricalcium Phosphate (TCP) dengan Bantuan Ekstrak Daun Alpukat (Percea americana) Yessi Rahmayani; Zulhadjri Zulhadjri; Syukri Arief
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 5, No. 1, May 2019
Publisher : Syarif Hidayatullah State Islamic University

Sintesis nanopartikel perak-TCP telah dilakukan pada penelitian ini. Nanopartikel perak dibuat dengan mereduksi larutan perak nitrat dengan menggunakan ekstrak daun alpukat sebagai bioreduktor. Tricalsium Phosphate (TCP) dicelupkan kedalam nanopartikel perak membentuk komposit perak-tricalcium phosphate. Hasil analisis UV-Vis menunjukkan pembentukan puncak serapan nanopartikel perak pada panjang 445-446 nm, yakni puncak yang khas dari nanopartikel perak yang disebabkan oleh adanya fenomena Surface Plasmon Resonance (SPR). Penelitian ini menghasilkan perak-TCP dengan ukuran nanopartikel. Sesuai hasil X-Ray Diffraction (XRD) yang menunjukkan bahwa ukuran kristal TCP adalah 64 nm dan ukuran Kristal perak dalam komposit adalah 46 nm. Hasil Scanning Electron Microscopy (SEM) menunjukan partikel perak terdistribusi dipermukaan partikel TCP. Kata Kunci: Komposit perak-TCP, nanopartikel perak, Percea americana, tricalcium phosphate. The silver-TCP nanoparticle synthesis was carried out in this study. Silver nanoparticles are made by reducing silver nitrate solution using avocado leaf extract as a bioreactor. Tricalcium Phosphate (TCP) is dipped into silver nanoparticles to form a silver-tricalcium phosphate composite. The UV-Vis analysis shows the formation of silver nanoparticle absorption peaks at a length of 445-446 nm, which is a typical peak of silver nanoparticles caused by the Surface Plasmon Resonance (SPR) phenomenon. X-Ray Diffraction (XRD) shows that the TCP crystal size is 64 nm and the size of the Silver Crystal in the composite is 46 nm. The results of Scanning Electron Microscopy (SEM) show silver particles distributed on the surface of TCP particles Keywords: Percea americana, silver-TCP composite, silver nanoparticle, tricalcium phosphate.

Degradasi Zat Warna Direct Red-23 Secara Fotolisis dengan Katalis C-N-codoped TiO2 Yuli Okta Fitriyani; Upita Septiani; Diana Vanda Wellia; Reza Audina Putri; Safni Safni
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 3, No. 2, November 2017
Publisher : Syarif Hidayatullah State Islamic University

Zat warna direct red-23 merupakan pewarna sintetik dengan struktur senyawa organik yang bersifat non-biodegradable. Zat warna direct red-23 mengandung senyawa azo dan bersifat karsinogenik. Zat warna direct red-23 didegradasi secara fotolisis menggunakan sinar UV (ultraviolet), sinar matahari, tanpa dan dengan penambahan katalis C-N-codoped TiO2. Larutan zat warna direct red-23setelah dan sebelum didegradasi diukur dengan spektrofotometer UV-Vis pada panjang gelombang 400-800 nm. Penentuan berat optimum katalis C-N-codoped TiO2 dilakukan dengan metode fotolisis sinar UV dan didapatkan berat optimum 15 mg. Persen degradasi zat warna direct red-23 secara fotolisis sinar UV dan sinar matahari tanpa katalis C-N-codoped TiO2 27.47% dan 13.74%. Persen degradasi meningkat menjadi 68.68% dan 28.57% dengan penambahan 15 mg katalis C-N-codoped selama 120 menit fotolisis. Dari penelitian dapat disimpulkan metode fotolisis dengan sinar UV lebih efisien dibandingkan dengan sinar matahari. Direct red-23 dye is a synthetic dye that is widely used in textile industry. Wastes generated from textile industrial processes are generally non-biodegradable organic compounds containing azo compounds and carcinogenic. Direct red-23 dye was degraded by photolysis UV Light method, solar irradiation, without and addition of C-N-codoped TiO2 catalyst. The results degradation of direct red-23 were measured with a UV-Vis spectrophotometer at wavelength of 400-800 nm. Determination of optimum weight of the C-N-codoped TiO2 catalyst was performedby photolysisUV Light methodand the optimum C-N-codoped TiO2catalyst is obtained 15 mg. Percent degradation of direct red-23 dye by photolysis of UV light and solar irradiation without C-N-codoped TiO2to 27.47% and 13.74%. Percent degradation increasedto 68.68% and 28.57% by addingC-N-codoped TiO2 catalyst was adding 120 menutes of photolysis.From the research it can be concluded by photolysis with UV Light methodis more efficient compared to solar radiation.

Transcription of Cell Wall Mannoproteins-1 gene in Saccharomyces cerevisiae Mutant Hermansyah Hermansyah
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 4, No. 2, November 2018
Publisher : Syarif Hidayatullah State Islamic University

Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases. The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role. In this research, the disruption of DPPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101). A BamHI - BamHI fragment 3,28 kb DPPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of DPPG1::CgHIS3 in FY833 and did not show 200mg/ml Calco fluor sensitivity, while another mutant DPPG1::CgHIS3 in W303-IA show 100mg/ml congo red sensitivity. Furthermore, to confirm whether DPPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR’s data showed that transcriptional level of CWP1 in DPPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly.

Docking Interaction of Protein Tyrosine Phosphatase and Complex Chromium(III) Nicotinate Compounds Yuli Ambarwati; MA Martoprawiro; I Mulyani; Ismunandar Ismunandar; D Onggo
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 3, No. 2, November 2017
Publisher : Syarif Hidayatullah State Islamic University

Docking simulation is important in the process of drug design, mainly used for the prediction of interactions receptor(protein)–substrate. This study aims to understand the interaction between Chromium(III) nicotinate [Cr(O-nic)2(OH-) (H2O)3] and [Cr(N-nic)2(OH-)(H2O)3] with the position of trans and cis as a substrate with receptors Protein Tyrosine Phosphatase(PTP). The chromium(III) nicotinic complexes an antidiabetic supplement that have been demonstrated in vitro, to determine the role of chromium(III) nicotinic as a supplement antidiabetic learned through the docking mechanism. The optimization of the complex structure of chromium(III) nicotinic using Gaussian 09, the docking process is performed using Autodock Vina. The docking results showed that trans[Cr(O-nic)2(OH-)(H2O)3] position interact with Leu13, Gly14, Cys17, Arg18, Trp49 and Asn50 with the interaction energy is -6.5 kcal/mol. As for the structure model cis[Cr(O-nic)2(OH-)(H2O)3] have -6.1 kcal/mol interaction energy and the amino acid Ile16, Trp49, Asn50, Arg53, Asp56 and Tyr131. The similar things at modelof N-coordinated to Cr withtrans[Cr(N-nic)2(OH-)(H2O)3] position interact with amino acids Leu13, Ser47, Trp49, Asn50 and Tyr131 the interaction energy is -6.5 kcal/mol. The ONIOM calculation showed the bond between the complexes of chromium(III) nicotinic with PTP is hydrogen bonding. The best interactions with the receptor are the structure model trans[Cr(O-nic)2(OH-)(H2O)3] with the lowest interaction energy interaction.

Page 18 of 43 | Total Record : 425

16 17 18 19 20

Filter by Year

2007 2025

Filter By Issues

All Issue Jurnal Kimia VALENSI, Volume 11, No. 2, November 2025 Jurnal Kimia VALENSI, Volume 11, No. 1, May 2025 Jurnal Kimia VALENSI, Volume 10, No. 2, November 2024 Jurnal Kimia VALENSI, Volume 10, No. 1, May 2024 Jurnal Kimia VALENSI Volume 9, No. 2, November 2023 Jurnal Kimia VALENSI Volume 9, No. 1, May 2023 Jurnal Kimia VALENSI Volume 8, No. 2, November 2022 Jurnal Kimia VALENSI Volume 8, No. 1, May 2022 Jurnal Kimia VALENSI Volume 7, No. 2, November 2021 Jurnal Kimia VALENSI Volume 7, No. 1, May 2021 Jurnal Kimia VALENSI Volume 6, No. 2, November 2020 Jurnal Kimia VALENSI Volume 6, No. 1, May 2020 Jurnal Kimia VALENSI Volume 5, No. 2, November 2019 Jurnal Kimia VALENSI Volume 5, No. 1, May 2019 Jurnal Kimia VALENSI Volume 4, No. 2, November 2018 Jurnal Kimia VALENSI Volume 4, No. 1, Mei 2018 Jurnal Kimia VALENSI Volume 3, No. 2, November 2017 Jurnal Kimia VALENSI Volume 3, No. 1, Mei 2017 Jurnal Kimia VALENSI Volume 2, No. 2, November 2016 Jurnal Kimia VALENSI Volume 2, No. 1, Mei 2016 Jurnal Kimia VALENSI Volume 1, No. 2, November 2015 Jurnal Kimia VALENSI Volume 1, No. 1, Mei 2015 Jurnal VALENSI Volume 4, No. 2, November 2014 Jurnal Valensi Volume 4, No.1, Mei 2014 Jurnal Valensi Volume 3, No.2, November 2013 Jurnal Valensi Volume 3, No.1, Mei 2013 Jurnal Valensi Volume 2, No.5, November 2012 Jurnal Valensi Volume 2, No.4, Mei 2012 JURNAL Valensi Volume 2, No. 3, November 2011 Jurnal Valensi Volume 2, No.2, Mei 2011 Jurnal Valensi Volume 2, No.1, November 2010 Jurnal Valensi Volume 1, No.6, Mei 2010 Jurnal Valensi Volume 1, No.5, November 2009 Jurnal Valensi Volume 1, No.4, Mei 2009 Jurnal Valensi Volume 1, No.3, November 2008 Jurnal valensi Volume 1, No.2, Mei 2008 Jurnal Valensi VOLUME 1, NO.1, NOVEMBER 2007 More Issue

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name
Dr. Sandra Hermanto, M.Si

Contact Email
hermantokimia@uinjkt.ac.id

Phone
+6285220042401

Journal Mail Official
kimia@uinjkt.ac.id

Editorial Address
Program Studi Kimia, Fakultas Sains dan Teknologi, UIN Syarif Hidayatullah Jakarta

Location
Kota tangerang selatan,

Banten

INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name Dr. Sandra Hermanto, M.Si

Contact Email hermantokimia@uinjkt.ac.id

Phone +6285220042401

Journal Mail Official kimia@uinjkt.ac.id

Editorial Address Program Studi Kimia, Fakultas Sains dan Teknologi, UIN Syarif Hidayatullah Jakarta

Location Kota tangerang selatan, Banten INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Contact Name
Dr. Sandra Hermanto, M.Si

Contact Email
hermantokimia@uinjkt.ac.id

Phone
+6285220042401

Journal Mail Official
kimia@uinjkt.ac.id

Editorial Address
Program Studi Kimia, Fakultas Sains dan Teknologi, UIN Syarif Hidayatullah Jakarta

Location
Kota tangerang selatan,

Banten

INDONESIA