Garuda - Garba Rujukan Digital

Article Per Year (5 Year)

All

Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati

biota
Website

Published by Universitas Atma Jaya Yogyakarta

ISSN : 25273221 EISSN : 2527323X DOI : doi.org/10.24002/biota

Core Subject : Science, Agriculture,

Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology

Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati merupakan jurnal ilmiah yang memuat hasil-hasil penelitian, kajian-kajian pustaka dan berita-berita terbaru tentang ilmu dan teknologi kehayatian (biologi, bioteknologi dan bidang ilmu yang terkait). Biota terbit pertama kali bulan Juli 1995 dengan ISSN 0853-8670. Biota terbit tiga nomor dalam satu tahun (Februari, Juni, dan Oktober).

Arjuna Subject : Ilmu Pertanian dan Biologi (Semua) - Ilmu Pertanian dan Biologi (Lain-Lain)

Articles 1,183 Documents

23 24 25 26 27

Pemanfaatan Ekstrak Daun Kecubung (Datura metel L.) Sebagai Pembius Ikan Koi (Cyprinus carpio L.) Pada Saat Pengangkutan Hariyanto, Sapto Eko; Pranata, F. Sinung; Aida, Yuniarti
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 13, No 1 (2008): February 2008
Publisher : Universitas Atma Jaya Yogyakarta

Either decorative fish or consumption fish would be costlier in price if sold in a state of life. However both having the same problems that is death at the time of transportation process. From former research has been obtained information that transportation of fish in a state of life can be done by using material anaesthesia either experiencing and also artificial. Usage of chemical material as fish anaesthetic is felt able to give unfavourable effect to quality and fish health. Purpose of this research knows concentration of metel thorn apple leaf extract and soaking stripper that is most effective in anaesthesia of fish koi (Cyprinus carpio L.) and knows does metel thorn apple leaf extract can lessen fish mortality koi (Cyprinus carpio L.) at the time of transportation of long distance. Initial concentration which will be applied is 0,4%, 0,1%, 0,06%, 0,03% and 0% as control, because concentration doesn't have an effect on concentration is boosted up to become 0,4%, 0,7% and 1% with soaking stripper 4, 8, 12 hours. Result of research shows concentration of 0,7% and soaking stripper of 8 hour, this time is most effective in anaesthesia of fish koi (Cyprinus carpio L.) because level of survival rate 100% with induction time stripper and recovery time is stripper. Research is continued with test trasportasi compared to control, where fish is not anaesthetized packed into plastic poke and given with pure oxygen like treatment that is usualy is done the fish farmers in process of transportation. Result of this research indicates that, treatment of fish anaesthetized with metel thorn apple leaf extract level of pass of life reachs 91,667% while controlling 66,667%. From result of inferential research that usage of metel thorn apple leaf extract at the time of transportation of proven long distance can lessen fish mortality koi (Cyprinus carpio L.).

Produksi Rennet Mucor pusillus yang Ditumbuhkan pada Limbah Padat Tapioka (Onggok) Choliq, Abdul
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 13, No 3 (2008): October 2008
Publisher : Universitas Atma Jaya Yogyakarta

The production of rennet enzyme extracted from Mucor pusillus in â€œonggokâ€ medium the effect of incubation peptone and ammonium nitrate to enzyme production, and the effect of pH and temperature to the activities of rennet were found. The statistical method used is Completed Randomized Design with 3 replicates for each treatment, with the rennet activity in RU/ml enzyme extract. The rennet production was conducted in erlenmeyer (100 ml) that contain 17.5 g â€œdry onggokâ€ and 50 ml solution of suspension used. The effect of incubation time was detected in three incubation times (4, 7, and 10 day), while effect of peptone and ammonium nitrate to the production of the rennet enzyme was detected in 4 concentrations (0, 1, 2, and 3%) for 7 days of incubation times. The effect of pH to the activity of rennet from the treatment of adding peptone 1% with 7 days incubation time was detected in 5 pH variation (5, 5.5, 6, 6.5 and 7) while the effect of temperature were detected in 5 variations (30, 35, 40, 45, and 50oC). The research results showed that the time of incubation, the addition of peptone and ammonium nitrate affected significantly to enzyme production of rennet Mucor pusillus in â€œonggokâ€ medium. The highest production of the rennet enzyme products was in the addition of peptone 1% (12.53 RU/ml) with 7 days incubation time. On the treatment of temperature and pH, the optimum activity of rennet Mucor pusillus was in pH 5.5 (40.03 RU/ml) and the activity of rennet Mucor pusillus increased up to temperature of 50oC.

Producing the Greatest Good for Greatest Numbers-Implementation of Utilitarianism Principle: The Case Study of Producing Recombinant Protein of JDV Margawati, Endang Tri
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 2 (2010): June 2010
Publisher : Universitas Atma Jaya Yogyakarta

Advanced technology in molecular biology often uses microorganism, consequently, researcher should have a responsibility in producing of laboratory products safely both for human and their environment. This presentation was intended (1) to report recombinant protein research in the Jembrana Disease Virus (JDV); (2) to identify relevancy of the ethics towards the research of recombinant protein and (3) to discuss relationship of utilitarianism principle with the development of the recombinant protein. The Jembrana disease is an infectious virus caused by a virus classified as retrovirus of Retrovidae family. The disease only attacks Bali cattle (Bos javanicus) that caused about 20% mortality rate. Up to present, crude vaccine from lymph organ of acute infected Bali cattle is often used for vaccination. Development of the Jembrana vaccine was attempted to increase the availability of qualified Jembrana vaccine by recombinant DNA approaches subsequently could be used as vaccine substances. This article was presented with much bioethics issues in associated with recombinant protein research and other examples of related research which use micro-organism in their investigation. It is expected that bioethics could be a restrain for researchers who deal with advanced technology in their investigation.

Sumberdaya Teripang (Holothuroidea) Di Kepulauan Sekotong, Nusa Tenggara Barat Yusron, Eddy
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 8, No 2 (2003): June 2003
Publisher : Universitas Atma Jaya Yogyakarta

Observation on sea cucumber diversity was carried out at coastal waters of Sudak and Nanggu Islands in the West Part of Sekotong Island, April and JuneÂ 2002. Sampling was done by using a transect quadrant of 1 m x 1 m. This sampling and observation on its microhabitat were conducted by scuba diving. Analyses on the sea cucumber community structure were based on its frequency of occurance, diversity, and density. The results showed that at both locationsÂ 11 species of sea cucumber were found whereÂ Holothuria scabra, H.atra, H nobilis, and Bohadschia marmorataÂ were predominant, common and more evenly distributed than the other species.

Respon Pertumbuhan Bibit Picrasma javanica Blume terhadap Intensitas Naungan dan Media Tanam Setyowati, Ninik; Utami, Ning Wikan
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 14, No 1 (2009): February 2009
Publisher : Universitas Atma Jaya Yogyakarta

Study on the growth response of Picrasma javanica Blume seedling to different shading intensities and medium was conducted at the Experimental Garden of Treub Laboratory, Research Centre for Biology, LIPI from June to December 2007. The research was arranged using Factorial in Completely Randomized Block Design with 2 factors and 5 replications. The first factor was shading intensities which were 0% (N0, without shading, average light intensities 39300 lux), 25% (N1, average light intensities 16430 lux), and 50% (N2, average light intensities 5867 lux), respectively and the second factor was medium (combinations of soil: manure:compost) with 6 levels were M1= 1:0:0, M2= 1:1:1, M3= 1:1:2, M4= 3:1:1, M5= 1:2:1, and M6= 2:1:1. The result showed that the N0 treatment (without shading) resulted the best growth response of Picrasma javanica Blume seedling, as showe in all parameters observed (plant height 27.11 cm; leaf number 15.57; diameter of trunk 4.32 mm; and root length of 15.97 cm, shoot dry weight of 1.762 g, root dry weight of 0.688 g and seedling quality index of 0.277). The growth media treatment of M5 (1-soil:2 manure:1 compost) showed the positive response on the growth of seedling better than other treatments and different with control (M1, soil media), with parameters were observed which was plant height 25.05 cm (M1= 19.10 cm); leaf number 16.53 (M1= 9.20); diameter of trunk 3.89 mm (M1= 2.76 mm); root lengh 15.23 cm (M1= 12.71 cm); shoot dry weight 1.58 g (M1= 0.663 g); root dry weight 0.51 g (M1= 0.221 g) and seedling quality index 0.220 (M1= 0.089). The combination treatment of N0 (without shading) and media M5 (1:2:1) gave the best response on the growth of Picrasma seedling (plant height 36.14 cm; leaf number 28.2; diameter of trunk 4.7 mm; and root length 16.7 cm, shoot dry weight 3 g and root dry weight 0.92 g).

Kajian Kehadiran Inang Primer pada Pertumbuhan Semai Cendana Wawo, Albertus Husein
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 9, No 2 (2004): June 2004
Publisher : Universitas Atma Jaya Yogyakarta

SandalwoodÂ (Santalum album L.)Â is known as a fancy plant. Since they haveÂ high economic value, it often over exploited.Â As a consequence, the population Â dramatically decreasedÂ in their habitats.Â Some effortsÂ have beenÂ doneÂ to conserveÂ this plantÂ in order to prevent their extinction, i.e.Â seedling multiplication.Â As aÂ hemiparasitic plant,Â sandalwoodsÂ need otherÂ plants for a host which growÂ around.Â Therefore, determining of the the primary host is a necessary aspect in multiplicationÂ ofÂ sandalwood seedling.Â This studyÂ usedÂ threeÂ speciesÂ plantsÂ to serve sandalwood seedlingÂ Â asÂ primary hostÂ in pot cultures consist of local leucaena (Leucaena glauca), vilosa (Acacia villosa)Â Â and calliandraÂ (CalliandraÂ calothyrsus). Â Â The resultsÂ of this study indicatedÂ Â that A. vilosaÂ is better for a primaryÂ hostÂ thanÂ L. glauca andÂ C. calothyrsus as well. Number ofÂ root connectionÂ betweenÂ sandalwood seedlingsÂ Â and their hostsÂ have a close correlationshipÂ Â toÂ the leafÂ numberÂ and theÂ sandalwood seedlingÂ Â dry weight, whereas no significant correlationshifp to their height.Â Â Â

Potensi Hiperakumulasi Saccharum spontaneum pada Medium Limbah Tailing Terkontaminasi Sianida Hidayati, Nuril; Juhaeti, Titi; Syarif, Fauzia
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 13, No 2 (2008): June 2008
Publisher : Universitas Atma Jaya Yogyakarta

One approach to minimize risks from some toxic pollutants is phytoextraction using hyperaccumulator plants. These remarkable plant species accumulate appreciable high concentration of pollutants, including cyanide than normal plants. Although cyanide is not categorized as heavy metal, its presence is considered as one of important toxic pollutants in the environment. Detoxification of cyanide contaminated soils and waters with plants seems to be a feasible option. Since plants vary in their ability to accumulate specific contaminants, it is necessary to select plant species that can both accumulate and tolerate the contaminants. This study aims to characterized plants that grow under extreme contaminated media of gold mined tailing belongs to PT ANTAM Cikotok and to analyse their potencies as hyperaccumulators. Saccharum spontaneum which was proven tolerant and dominant in the contaminated site as well as potential in producing high biomass was used in this research. The plants were grown in tailing waste media added by 0, 5 and 10 mg kg-1 CN. Organic fertilizers i.e. manure and compost were applied to increase CN uptake. The results showed that the plants were capable of growing under the highest level of CN. Application of organic fertilizer increased plant uptake. The results indicated that Saccharum spontaneum can be considered as high tolerance and potentially effective in accumulating CN in their roots and above ground portions.

Peningkatan Produksi Asam Glutamat Corynebacterium glutamicum dengan Penambahan Penisilin pada Fase Logaritmik Mursyanti, Exsyupransia; Lestari, Sri
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 10, No 2 (2005): June 2005
Publisher : Universitas Atma Jaya Yogyakarta

One way to increase production and excretion of glutamic acid was to increase cell's permeability. Penicillin has a potency to change the cell permeability by inhibitng cell wall synthesis. However, penicillin treatment was effective only for actively dividing cells. Therefore, such a research was done to study on the time of penicillin treatment to the medium, so that it can be found optimal cell biomass to produce maximum glutamic acid. The cell utilized in the research was Corynebacterium glutamicum IFO 12168 that was in batch cultured. Concentration of penicillin added was 5 unit/ml and treated at incubation periods 12, 14, 16, 18, and 20 hours, respectively, after inoculation. The steps of the research were as follows purification test, growth pattern, and glutamic acid production. Parameters measured at the end of the fermentation were cell biomass, reduced sugar concentration, mediumâ€™s pH, and glutamic acid concentration. Data was analysed utilizing Anova and the significant difference between treatments were tested using Duncanâ€™s Multiple Range Test (DMRT). The growh pattern shown that logarithmic phase was reached at 2 to 22 hrs of incubation periods, therefore the treatment of penicillin was given at 12, 14, 16, 18, and 20 hrs of incubation periods. Cell biomass produced was corelate with the concentration of reduced sugar in the medium. Measured pH of the medium at the end of the fermentation was on the pH range for the growth of C. glutanicum. The research concluded that Penicillin treatment was able to increase significantly the glutamic acid production compatred to control treatment. Time accuracy of penicillin treatment to produce maximum glutamic acid (154319,60 Âµg/ml) was on 18 hrs of incubation period.

Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene Astuti, Yohana Theresia; Dewi, Kumala; Santosa, Santosa; Prawoto, A. Adi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.

Sistematik Filogenetik Pseudomonas Strain Indigenous Pendegradasi Liniar Alkilbenzen Sulfonat Suharjono, Suharjono; Sembiring, Langkah; Subagja, Yusup; Widayati, Wiwik E.
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 1 (2010): February 2010
Publisher : Universitas Atma Jaya Yogyakarta

Linear Alkylbenzene Sulphonate (LAS) was the dominant pollutant in the river ecosystem. Indigenous strains of Pseudomonas in river ecosystem had highly potency to LAS degradation. This research was carried out to study relationship of indigenous strains of LAS degrading to Pseudomonas strains. Indigenous strains of bacteria of LAS degrading were characterized based on ARDRA (Amplified Ribosomal 16S rDNA Restriction Analysis) and 16S rDNA sequence. Result of the research shows that Pseudomonas strain J and R which LAS degrading from detergent polluted river ecosystem based on 16S rDNA sequence, isolate J has 98.37% similarity and it has relationship to P. pseudoalcaligenes LMG 1225T whereas isolate R has 84.86% similarity and related to P. stutzeri phen8.

Page 25 of 119 | Total Record : 1183

23 24 25 26 27

Filter by Year

2003 2025

Filter By Issues

All Issue Vol 10, No 3 (2025): October 2025 Vol 10, No 2 (2025): June 2025 Vol 10, No 1 (2025): February 2025 Vol 9, No 3 (2024): October 2024 Vol 9, No 2 (2024): June 2024 Vol 9, No 1 (2024): February 2024 Vol 8, No 3 (2023): October 2023 Vol 8, No 2 (2023): June 2023 Vol 8, No 1 (2023): February 2023 Vol 7, No 3 (2022): October 2022 Vol 7, No 2 (2022): June 2022 Vol 7, No 1 (2022): February 2022 Vol 6, No 3 (2021): October 2021 Vol 6, No 2 (2021): June 2021 Vol 6, No 1 (2021): February 2021 Vol 5, No 3 (2020): October 2020 Vol 5, No 2 (2020): June 2020 Vol 5, No 1 (2020): February 2020 Vol 4, No 3 (2019): October 2019 Vol 4, No 2 (2019): June 2019 Vol 4, No 1 (2019): February 2019 Vol 4, No 1 (2019): February 2019 Vol 3, No 3 (2018): October 2018 Vol 3, No 2 (2018): June 2018 Vol 3, No 1 (2018): February 2018 Vol 3, No 1 (2018): February 2018 Vol 2, No 3 (2017): October 2017 Vol 2, No 2 (2017): June 2017 Vol 2, No 1 (2017): February 2017 Vol 2, No 1 (2017): February 2017 Vol 1, No 3 (2016): October 2016 Vol 1, No 2 (2016): June 2016 Vol 1, No 1 (2016): February 2016 Vol 1, No 1 (2016): February 2016 Vol 19, No 1 (2014): February 2014 Biota Volume 19 Nomor 1 Tahun 2014 Biota Volume 13 Nomor 2 Tahun 2014 Vol 18, No 2 (2013): June 2013 Vol 18, No 1 (2013): February 2013 Biota Volume 18 Nomor 1 Tahun 2013 Vol 17, No 3 (2012): October 2012 Vol 17, No 2 (2012): June 2012 Vol 17, No 1 (2012): February 2012 BIOTA Volume 17 Nomor 3 Tahun 2012 Vol 16, No 2 (2011): June 2011 Vol 16, No 2 (2011): June 2011 Vol 16, No 1 (2011): February 2011 Vol 16, No 1 (2011): February 2011 Vol 15, No 3 (2010): October 2010 Vol 15, No 2 (2010): June 2010 Vol 15, No 1 (2010): February 2010 Vol 14, No 3 (2009): October 2009 Vol 14, No 2 (2009): June 2009 Vol 14, No 1 (2009): February 2009 Vol 13, No 3 (2008): October 2008 Vol 13, No 2 (2008): June 2008 Vol 13, No 1 (2008): February 2008 Vol 12, No 3 (2007): October 2007 Vol 12, No 2 (2007): June 2007 Vol 12, No 1 (2007): February 2007 Vol 11, No 3 (2006): October 2006 Vol 11, No 2 (2006): June 2006 Vol 11, No 1 (2006): February 2006 Vol 10, No 3 (2005): October 2005 Vol 10, No 2 (2005): June 2005 Vol 10, No 1 (2005): February 2005 Vol 9, No 3 (2004): October 2004 Vol 9, No 2 (2004): June 2004 Vol 9, No 1 (2004): February 2004 Vol 8, No 3 (2003): October 2003 Vol 8, No 2 (2003): June 2003 Vol 8, No 1 (2003): February 2003 More Issue

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name
Brigitta Laksmi Paramita

Contact Email
brigitta.laksmi@uajy.ac.id

Phone
+6282329549978

Journal Mail Official
journal.biota@gmail.com

Editorial Address
Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia

Location
Kota yogyakarta,

Daerah istimewa yogyakarta

INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name Brigitta Laksmi Paramita

Contact Email brigitta.laksmi@uajy.ac.id

Phone +6282329549978

Journal Mail Official journal.biota@gmail.com

Editorial Address Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia

Location Kota yogyakarta, Daerah istimewa yogyakarta INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Contact Name
Brigitta Laksmi Paramita

Contact Email
brigitta.laksmi@uajy.ac.id

Phone
+6282329549978

Journal Mail Official
journal.biota@gmail.com

Editorial Address
Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia

Location
Kota yogyakarta,

Daerah istimewa yogyakarta

INDONESIA