cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota denpasar,
Bali
INDONESIA
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry)
Published by Universitas Udayana
ISSN : -     EISSN : 23027274     DOI : -
Core Subject : Science, Engineering,
Chemical Engineering, Chemistry & Bioengineering Chemistry Electrical & Electronics Engineering
Jurnal ini merupakan jurnal elektronik di bidang kimia terapan yang dikelola oleh Magister Kimia Terapan, Program Pascasarjana, Universitas Udayana, Bali. Jurnal ini memuat artikel-artikel penelitian yang berhubungan dengan Kimia Terapan yang meliputi Kimia Analitik, Kimia Polimer, Biokimia, Kimia Bahan Alam, Kimia Fisik, Kimia Permukaan, Biomaterial,dan bidang-bidang terkait. Jurnal ini akan terbit 2 kali dalam setahun yaitu pada bulan Pebruari dan September. Jurnal ini terbuka untuk diakses oleh semua kalangann(Open Access Journal)
Arjuna Subject : -
Articles 184 Documents
 15   16   17   18   19 
VALIDASI METODE UJI ARSEN MENGGUNAKAN INDUCTIVELY COUPLED PLASMA EMISSION SPECTROMETRY (ICPE) 9000 Ni Nyoman Trisnawati; I Gst. Ayu Kunti Sri Panca Dewi; Putu Primantari Vikana Suari; Ni Putu Ayu Krismayanti
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 10 No 2 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Laboratorium Analitik merupakan laboratorium pendidikan yang berfungsi sebagai penunjang kegiatan Tri Dharma Perguruan Tinggi, yaitu memberikan praktikum kepada mahasiswa, praktek kerja lapangan, membantu uji kimia dalam penelitian mahasiswa dan dosen, serta melayani masyarakat untuk uji kimia dan fisika. Salah satu parameter yang di uji oleh pelanggan adalah Logam Arsen (As). Logam tersebut merupakan salah satu logam yang sangat berbahaya dan beracun sehingga sangat membahayakan kesehatan. Oleh karena itu, logam tersebut diuji menggunakan instrumentasi ICPE 9000 dengan larutan standar Arsen (As) Fixanal. Larutan standar tersebut belum CRM sehingga perlu dilakukan validasi standar. Validasi standar digunakan untuk membuktikan bahwa larutan standar yang digunakan dalam metode uji memenuhi persyaratan sehingga diperoleh data yang akurat dan dapat dipercaya. Adapun manfaat dari penelitian ini adalah untuk mendapatkan larutan standar Arsen yang telah tervalidasi. Metode validasi yang digunakan dalam penelitian ini terbagi menjadi 5 metode yaitu uji presisi, akurasi, LOD, LOQ, dan linieritas. Hasil yang diperoleh pada penelitian ini adalah nilai r sebesar 0,9982, nilai LOD dan LOQ sebesar 0,06 mg/L dan 0,2 mg/L, dan sudah terkonfirmasi, hasil uji akurasi termasuk dalam rentang yang ditetapkan yakni 90 - 110%, hasil uji presisi memiliki nilai % RSD < 2/3 CV Horwitz. Hasil yang diperoleh sudah memenuhi persyaratan sehingga larutan stok standar arsen fixanal sudah valid sebagai standar untuk digunakan dalam metode uji. ABSTRACT: The Analytical Laboratory of Udayana University is Laboratory work follows the three responsibilities of Higher Education in Indonesia, namely teaching, research and social service. The laboratory serves academic staffs, students of Udayana University and clients outside Udayana University in the area of chemical and physical analysis, research and training. One of the parameter that often tested in this laboratory by academic staffs, students and other clients is Arsenic (As). This metal is one of the most dangerous and toxic metals, because it is very dangerous to health. Therefore, the metal was tested using ICPE 9000 (Inductively Coupled Plasma Emission). Certified standard solutions are usually used to calibrate the instrument but we have standard solution of uncertified arsenic. Because of that, the standard solution with a arsenic standard solution of fixanal have to validated to obtain valid and reliable result. Validation methods in this study consisted of 5 tests namely precision, accuracy, LOD, LOQ and Linearty tests. The results of the five tests were: r value was 0,9982; the value of LOD and LOQ were 0,06 mg/L and 0,20 mg/L respectively and they were already confirmed: result of accuracy was in the range of 90-110 %. Result of precision test was % RSD < 2/3 CV Hortwitz. From the above results it could be concluded that the standard solutions of arsenic that made from fixanal arsenic solution were valid and could be used for arsenic analysis with a reliable result and was valid to use in determination of arsenic (As).
BIOAVAILABILITAS TIMBAL (Pb) DAN TEMBAGA (Cu) DALAM TANAH PERTANIAN SERTA KANDUNGANNYA DI DALAM BIJI PADI Ni Desak Komang Ayu Hartani; I Made Siaka; I Wayan Suarsa
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 10 No 2 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Penggunaan pupuk anorganik secara terus menerus pada tanah pertanian dapat menyebabkan peningkatan akumulasi logam berat dalam tanah tersebut. Penelitian ini bertujuan untuk mengetahui tingkat pencemaran, bioavailabilitas logam Pb dan Cu dalam tanah, dan kandungan logam tersebut dalam beras yang dihasilkan dari pertanian tersebut. Metode ekstraksi bertahap digunakan untuk spesiasi dan penentuan konsentrasi logamnya menggunakan instrumen AAS. Pada penelitian ini ditemukan bahwa kandungan logam total Pb dan Cu dalam tanah berturut-turut pada kisaran 58,76-70,22 mg/kg dan 66,60-72,31 mg/kg untuk tanah sebelum penanaman padi dan saat panen berkisar 65,33-78,09 mg/kg dan 71,07-82,25 mg/kg. Logam Pb dan Cu yang bioavailable pada tanah sebelum penanaman padi ditemukan paling rendah, yaitu 13,80-19,71% dan 10,82-11,69%, diikuti oleh logam non bioavailable: 35,33-38,83% dan 23,97-35,51%, dan paling tinggi adalah logam yang berpotensi bioavailable, yaitu 44,17-47,37% dan 52,98-64,62%. Akan tetapi, kandungan Pb dan Cu dalam beras berturut-turut 0.12-0,29 mg/kg dan 1,88-2,518 mg/kg. Berdasarkan hasil penelitian ini, tanah pertanian di Desa Kukuh, Tabanan tergolong tidak tercemar menurut nilai the former Greater London Council (GLC), yaitu <500 mg/kg untuk Pb dan <100 mg/kg untuk Cu. Begitu juga, persentase logam yang bioavailable paling rendah, sehingga dapat diprediksi bahwa tidak lebih dari 20% logam-logam tersebut terakumulasi dalam tanaman. Ini terbukti bahwa kandungan Pb dan Cu dalam beras sangat kecil dan berada di bawah ambang batas yang diperbolehkan FAO/WHO, yaitu <0,3 mg/kg untuk Pb dan <10 mg/kg untuk Cu. Dengan demikian, beras yang diproduksi dari tanah pertanian tersebut tidak tercemar logam berat dan aman untuk dikonsumsi. ABSTRACT: The use of inorganic fertilizers on agricultural soils continuously and excessively can lead to an increase in the accumulation of heavy metals in the soil. This study aimed to determine the level of contamination, the bioavailability of Pb and Cu in soil, and their contents in rice produced from agriculture. The sequential extraction method was used to determine the bioavailability of the metals. In this study, it was found that the total metals content of Pb and Cu in the soil were 58.76-70.22 mg/kg and 66.60-72.31 mg/kg for the soil before planting rice and at harvest time were 65.33-78.09 mg/kg and 71.07-82.25 mg/kg, respectively. The Pb and Cu being bioavailable in the soil before planting rice were found to be the lowest at 13.80-19.71% and 10.82-11.69%, followed by non-bioavailable metals: 35.33-38.83% and 23.97-35.51%, and the highest were the metals being potentially bioavailable: 44.17-47.37% and 52.98-64.62%. However, Pb and Cu contents in rice were 0.12-0.29 mg/kg and 1.88-2.518 mg/kg. Based on the results of this study, agricultural soil in Kukuh Village, Tabanan was classified as unpolluted according to the value of the former Greater London Council (GLC) for Pb <500 mg/kg and <100 mg/kg for Cu). Moreover, it was found that the metals content in the rice was below the maximum limit allowed by FAO/WHO (<0.3 mg/kg for Pb and <10 mg/kg for Cu). Thus, rice produced from the agricultural soil of Kukuh-Tabanan was not contaminated by heavy metals and was safe for consumption.
PENENTUAN NILAI KM DAN VMAKS DARI ENZIM PAPAIN DALAM HIDROLISIS KONSENTRAT PROTEIN AMPAS TAHU Oka Ratnayani; Sakinatul Fatimah; Ketut Ratnayani; Ni Made Puspawati
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 10 No 2 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Sisa kandungan protein dalam ampas tahu yang masih cukup tinggi perlu dioptimalkan pemanfaatannya dengan cara mengisolasi komponen protein tersebut sehingga diperoleh konsentrat protein ampas tahu dan digunakan sebagi substrat untuk produksi hidrolisat protein. Penelitian ini bertujuan untuk menentukan kemampuan enzim papain dalam menghidrolisis konsentrat protein ampas tahu yaitu dengan menentukan nilai Km (Konstanta Michaelis-Menten) dan Vmaks (Kecepatan Maksimum). Tahap penelitian diawali isolasi protein total sehingga diperoleh konsentrat proteinnya.yang selanjutnya dihidrolisis secara parsial dengan enzim papain sehingga diperoleh produk hidrolisat protein. Proses isolasi protein ampas tahu menggunakan sampel ampas tahu segar dengan metode ekstraksi alkalik dilanjutkan dengan presipitasi isoelektrik mampu menghasilkan serbuk konsentrat protein dengan nilai kadar protein mencapai 50,36% sehingga memenuhi syarat sebagi konsentrat protein. Hasil penentuan nilai Km dan Vmaks enzim papain dalam menghidrolisis substrat konsentrat protein ampas tahu memperoleh nilai Km sebesar 237,0229 mg/mL dan nilai Vmaks sebesar 5,1975 mg/mL/menit. Hal ini menunjukkan bahwa enzim papain mampu menghidrolisis konsentrat protein ampas tahu sehingga menghasilkan produk hidrolisat protein ampas tahu. ABSTRACT: The remaining protein content in tofu dregs is still quite high, so that its utilization can be optimized by isolating the protein component to obtain the protein concentrate that can be used as a substrate for the production of protein hydrolysates. This study aimed to determine the ability of the papain enzyme to hydrolyze the protein concentrate of tofu dregs through determining the values ??of Km (Michaelis-Menten constant) and Vmax (Maximum Speed). The research steps began with the total protein isolation to obtain the protein concentrate, which was then partially hydrolyzed with papain enzymes to produce protein hydrolysate. The isolation of the tofu dregs protein from fresh tofu dregs samples was done by using an alkaline extraction method followed by isoelectric precipitation resulted in protein concentrate powder with a protein content value of 50.36%, so that it qualified as a protein concentrate. The determination of Km and Vmax values of the papain enzyme in hydrolyzing the protein concentrate substrate of tofu dregs obtained a Km value of 237.0229 mg/mL and a Vmax value of 5.1975 mg/mL/minute. This showed that the papain enzyme was able to hydrolyze the tofu dregs protein concentrate to produce a tofu protein hydrolyzate product.
KARAKTERISASI DAN UJI KEMAMPUAN AKTIVITAS SENYAWA ANTIOKSIDAN EKSTRAK JAHE MERAH (Zingiber officinale var rubrum) SECARA IN VITRO Miftakul Sururi; Ni Wayan Bogoriani; Ida Ayu Raka Astiti Asih
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 10 No 2 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Jahe merah adalah umbi yang mengandung antioksidan berupa terpenoid, polifenol dan minyak atsiri yang sangat berguna untuk menurunkan oksidan dalam tubuh manusia. Tujuan dari penelitian ini yakni menentukan IC50 fraksi dari ekstrak jahe merah, kadar total flavonoid dan fenol yang terdapat pada jahe merah dengan aktifitas antioksidan terkuat, dan mengidentifikasi senyawanya. Metode DPPH digunakan untuk menentukan aktivitas antioksidan dan metode Folin-Ciocalteu untuk menentukan total flavonoid dan fenol serta identifikasi senyawa aktif menggunakan LC MS/MS. Nilai IC50 fraksi air, n-heksan, dan fraksi kloroform secara berutut-turut 52,92 µg/ml, 149,92 µg/ml, dan 108,10 µg/ml. dengan total flavonoid dan fenol fraksi air 34,9045 mg/g QE dan 2,37 mg/g GAE. Hasil identifikasi LCMS/MS menunjukkan fraksi air jahe merah mengandung Senyawa antara lain 6-gingerol, Zerumbone, 6-shogaol dan 10-gingerol yang muncul pada waktu retensi 3.89; 5.90; 8.60 dan 10.11. Disimpulkan bahwa fraksi air jahe merah mempunyai aktivitas antioksidan terkuat dengan kandungan senyawa aktif yang berkontribusi sebagai antioksidan. ABSTRACT: Red ginger is a spice that contains antioxidant compounds of terpenoids, polyphenols, and essential oils which are very useful for reducing oxidants in the human body. The IC50 determination of fraction from extract red ginger, the total levels of flavonoids and phenols found in red ginger with the strongest antioxidant activity, and to identify the compounds. The antioxidant activity determination using DPPH methods and the total flavonoids and phenols determination using Folin-Ciocalteu methods meanwhile the identification of active compounds using LC-MS / MS. The antioxidant activity test showed that the IC50 values ??of the water fraction, n-hexane, and chloroform fraction were 52,92 µg/ml, 149,92 µg/ml, and 108,10 µg/ml, respectively. with total flavonoids and phenols, water fraction 34.9045 mg/g QE, and 2.37 mg / g GAE. The results of LCMS / MS identification showed that the red ginger water fraction contained compounds are 6-gingerol, Zerumbone, 6-shogaol, and 10-gingerol which appeared at retention time of 3.89; 5.90; 8.60, and 10.11. Conclusion is red ginger water fraction has the strongest antioxidant activity with active compounds that contribute as antioxidants.
PEMANFAATAN EKSTRAK KUNYIT (CURCUMA DOMESTICA VAL.) SEBAGAI ZAT PEWARNA ALAMI RAMAH LINGKUNGAN PADA KULIT JAGUNG Nurfidianty Annafi; Nursyofiatin Nursyofiatin; Agrippina Wiraningtyas; Sry Agustina
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Penelitian ini menggunakan kunyit (Curcuma Domestica Val.) sebagai zat warna alam ramah lingkungan dan diaplikasikan pada kulit jagung. Penelitian ini bertujuan untuk menganalisis pengaruh variasi waktu maserasi zat warna kunyit menggunakan pelarut aquades dan diaplikasikan pada kulit jagung. Metode penelitian menggunakan metode eksperiman kualitatif. Variasi waktu maserasi yang digunakan adalah 1 jam, 2 jam, 3 jam, 4 jam dan 5 jam. Hasil penelitian ini menunjukkan bahwa semakin lama waktu ekstraksi warna ekstrak yang dihasilkan semakin terang dan sifat kimianya menghasilkan nilai absorbansi yang berbeda-beda. Ekstrak zat warna tersebut diaplikasikan pada serat alam kulit jagung. Hasil pengaplikasian zat warna kunyit membuat kulit jagung berubah warna dari crem menjadi warna kuning. Semakin besar nilai absorbansi ekstrak yang digunakan maka efek warna yang dihasilkan semakin cerah. Proses fiksasi kulit jagung dengan tawas menghasilkan efek warna sesuai karakteristik zat fiksator tersebut yaitu menjadi tidak luntur dan lebih tahan lama. ABSTRACT: This study used turmeric (Curcuma Domestica Val.) ss an environmentally friendly natural dye and was applied to corn husks. This study aims to analyze the effect of variations in the maceration time of turmeric dyes using distilled water and applied to corn husks. The method used in this study is a qualitative experiment. The variation of maceration time used was 1 hour, 2 hours, 3 hours, 4 hours and 5 hours. The results of this study indicate that the longer the extraction time, the brighter the color of the extract will be and the chemical properties will produce different absorbance values. The dye extract is applied to the natural fibers of the corn husks. The result of the application of the turmeric dye makes the corn husks change color from cream to yellow. The greater the absorbance value of the extract used, the brighter the resulting color effect. The fixation process of corn husk with alum produces a color effect according to the characteristics of the fixator which is not faded and more durable.
HIDROLISIS PROTEIN KECAMBAH KACANG MERAH MENGGUNAKAN ENZIM PAPAIN DENGAN VARIASI RASIO ENZIM-SUBSTRAT Oka Ratnayani; Made Ririn Dwi Rahayu; Ketut Ratnayani; Ni Komang Ariati
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Hidrolisis protein secara enzimatik dapat memproduksi hidrolisat protein yang akan menghasilkan peptida rantai pendek dan asam amino bebas, sehingga memiliki nilai gizi dan protein terlarut lebih tinggi dan lebih mudah dicerna. Penelitian akhir-akhir ini juga menunjukkan bahwa kecambah kacang merah (Phaseolus vulgaris L.) memiliki kadar protein terlarut lebih tinggi dibandingkan dengan kacang merah yang belum dikecambahkan. Maka, pada penelitian ini, kecambah kacang merah dijadikan substrat untuk menghasilkan hidrolisat protein menggunakan enzim papain yang relatif mudah didapat, tidak ada reaksi samping, tidak toksik, relatif tahan terhadap suhu, dan memiliki daya katalitik yang tinggi. Selain itu, salah satu faktor yang memengaruhi proses hidrolisis protein adalah rasio enzim-substrat (rasio E/S). Sehingga, tujuan dari penelitian ini adalah untuk mengetahui kadar ?-amino bebas, protein terlarut, dan derajat hidrolisis dari hidrolisat protein kecambah kacang merah hasil hidrolisis menggunakan variasi rasio enzim-substrat. Metode yang digunakan yaitu metode Ninhidrin untuk penentuan kadar ?- amino bebas, metode Biuret untuk penentuan kadar protein terlarut dan metode SN-TCA (Trichloroacetic acid-soluble nitrogen) untuk penentuan derajat hidrolisis. Adapun variasi rasio E/S yang digunakan yaitu 3, 4, 5, dan 6%. Hasilnya menunjukkan bahwa semakin tinggi rasio enzim-substrat, semakin meningkat pula nilai kadar ?-amino bebas, kadar protein terlarut, dan derajat hidrolisis dari hidrolisat protein yang dihasilkan. Hasil terbaik yang didapat, yaitu kadar ?- amino bebas, protein terlarut dan derajat hidrolisis masing masing sebesar 0,5536 mg/mL, 2,0726 mg/mL dan 36,02, diperoleh dari hidrolisis menggunakan rasio E/S 6%. ABSTRACT: The enzymatic protein hydrolysis can produce protein hydrolyzate that will bring out short-chain peptides and free amino acids which contain higher nutritional values and soluble protein content as well as easier to digest. Recently, it has also found that red bean sprouts (Phaseolus vulgaris L.) has higher dissolved protein content than red beans without germination. Thus, in this research, red bean sprouts were used as the substrate to produce protein hydrolysates by using papain enzymes. Papain enzymes are easier to obtain, no side reactions, non-toxic, relatively resistant to temperature, and have high catalytic ability. Moreover, one of the essential factors that affect the protein hydrolysis is the enzyme-substrate ratio (E/S ratio). Therefore, the purpose of this study was to determine the levels of free amino acids, soluble protein, and degree of hydrolysis of the protein hydrolyzate obtained from the hydrolysis of the red bean sprouts using various enzyme-substrate (E/S) ratio. The methods used were Ninhydrin method for determining the free amino acid levels, Biuret test for the soluble protein content and SN-TCA (Trichloroacetic acid-soluble nitrogen) method for the degree of hydrolysis. The variations of the E/S ratio used were 3, 4, 5, and 6%. The results showed that the higher the enzyme-substrate ratio, the higher the value of free amino acids, soluble protein, and degree of hydrolysis in the protein hydrolysate obtained. The highest values of free amino acid, the soluble protein content and the hydrolysis degree of the protein hydrolysate was 0.5536 mg/mL, 2.0726 mg/mL and 36.02%, respectively, obtained by using the hydrolysis with the E/S ratio of 6%.
EKSPLORASI RASIO KONSENTRASI CAMPURAN ASAM BORAT DAN ASAM FOSFAT UNTUK MENINGKATKAN SIFAT KETAHANAN API TERHADAP MATERIAL BERBASISKAN ORGANIK Irvan Ariantono; M.A. Elita Hafizah; L.A. Affandi; D. W. Ananda; Azwar Manaf; M. Manawan; Andreas Andreas
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Pada penelitian ini dilakukan investigasi efek dari variasi konsentrasi campuran senyawa asam borat dan asam fosfat sebagai flame retardant pada material organik kertas. Berdasarkan nilai batas kelarutan, asam borat (H3BO3) sebanyak 6,23 gram dilarutkan dalam 100 mL air deionisasi pada suhu 30°C disiapkan sebagai fasa awal. Larutan asam borat tersebut dilakukan pencampuran dengan asam fosfat (H3PO4) dengan rasio konsentrasi 99:1, 97:3, dan 95:5. Hasil campuran diidentifikasi dengan mengukur pH dan sifat ketahanan api. Sifat ketahanan api dipelajari melalui konsep pengujian pembakaran vertikal melalui parameter uji UL-94 dengan spesimen kertas. Arang hasil pembakaran dilakukan identifikasi dengan pengujian FTIR untuk mempelajari senyawa yang terbentuk pada arang dan SEM untuk mengidentifikasi morfologi dari arang yang terbentuk. Sifat pembakaran diperoleh pada sampel dengan konsentrasi 95wt% asam borat dan 5wt% asam fosfat merupakan sampel yang paling optimal sebagai flame retardant dan tidak bersifat korosif pada kertas. ABSTRACT: The effect of ratio of boric acid (H3BO3) to phophoric acid (H3PO4) in their mixtures on flame retardancy for organic based materials was invertigated in this study. Boric acid of 6.23 gram was dissolved in 100 mL of deionized water at 30oC. Further, the boric acid was mixed with phosphoric acid to obtain the concentration ratio of 99: 1; 97: 3; and 95:5. The pH and fire retardancy of the mixtures were measured. The fire retardancy was investigated by testing the vertical combustion using UL-94 parameter with paper specimen. The obtained charcoal was analyzed by FTIR to get information of resulted compounds and SEM to identify the morphology of the charcoal. The optimal flame retardancy was obtained by using 95:5 as flame retardant without having corrosive on the paper specimen.
DESAIN PRIMER SECARA IN SILICO UNTUK AMPLIFIKASI GEN COA PADA STAPHYLOCOCCUS AUREUS DENGAN POLYMERASE CHAIN REACTION Rhadevka Agnur Saputra; Didik Wahyudi
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Staphylococcus aureus merupakan bakteri penyebab berbagai infeksi kulit dan jaringan lunak serta penyebab penyakit yang lebih serius dan lebih invasif. Gen coa adalah gen penyandi enzim koagulase yang dimiliki Staphylococcus aureus. Gen coa dapat dideteksi dengan teknik Polymerase Chain Reaction (PCR). Metode PCR memerlukan sepasang primer. Primer dapat didesain secara in silico. Penelitian ini bertujuan untuk mengetahui apakah primer yang digunakan dapat memgamplifikasi gen coa pada Staphylococcus aureus. Primer didesain menggunakan software NCBI kemudian dilakukan uji kualitas primer menggunakan software oligoevaluator dan NetPrimers. Didapatkan 2 kandidat primer yaitu primer pertama forward 5’ CAAAGCAGATGCGATAGTGG 3’ reverse 5’ GTTCGCTTTATTTTCCGGCT 3’ dan primer kedua dengan forward 5’ AGCCGGAAAATAAAGCGAAC 3’ reverse 5’ ACCTTGAATTGTGCCTTGTG 3’. Hasil primer yang didesain diujikan dengan metode PCR. Hasil visualisasi kedua primer terbentuk pita DNA yang tebal dan jelas, tidak ada smear, namun terdapat primer dimer dan letak produk tidak sesuai dengan hasil analisis secara in silico. Primer yang didesain dapat digunakan untuk amplifikasi gen coa pada Staphylococcus aureus. Terdapat perbedaan spesifisitas antar primer yang didesain dimana primer 2 lebih baik dari primer 1. ABSTRACT: Staphylococcus aureus is bacteria that causes of a variety of skin and soft tissue infections and causes more serious and invasive disease. The coa gene is a coagulase enzyme gene that belongs to Staphylococcus aureus. The coa gene can be detected by Polymerase Chain Reaction (PCR) technique. The PCR method requires primers. Primer can be designed in silico. This study aims to determine whether the primer used can amplify the coa gene in Staphylococcus aureus. Primers were designed using NCBI software and then tested for primary quality using oligoevaluator and NetPrimers software. Two primary candidates were obtained, namely the first primer forward 5' CAAAGCAGATGCGATAGTGG 3' reverse 5' GTTCGCTTTATTTTCCGGCT 3' and the second primer forward 5' AGCCGGAAAATAAAGCGAAC 3' reverse 5' ACCTTGAATTGTGCCTTGTGTG 3'. The designed primary results were tested by the PCR method. The results of the visualization of the two primers formed thick and clear DNA bands, no smears, but there were dimer primers and the location of the products did not match the results of in silico analysis. The designed primer can be used for coa gene amplification in Staphylococcus aureus. There are differences in specifications between the designed primers where primer 2 is better than primary 1.
KANDUNGAN LOGAM Cu PADA SELADA SERTA PENGARUH PENAMBAHAN PUPUK KOMPOS TERHADAP BIOAVAILABILITASNYA PADA TANAH PERTANIAN Ni Kadek Diah Sri Widari; I Made Siaka; Ni Made Puspawati
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Penelitian ini dilakukan untuk mengetahui kandungan logam Cu total dalam tanaman selada serta pengaruh penambahan pupuk kompos terhadap bioavailabilitas tanah pertanian dari salah satu lahan di Candi Kuning, Bedugul. Metode yang digunakan adalah ekstraksi empat tahap (fraksinasi) dan absorbansinya diukur dengan spektrofotometer serapan atom (AAS) dan menggunakan metode kurva kalibrasi untuk penentuan konsentrasi sampel. Hasil penelitian menunjukkan bahwa penambahan pupuk kompos pada tanah pertanian dapat menurunkan konsentrasi Cu pada fraksi bioavailable sebesar 0,70-2,06 mg/kg (21,25-59,57%). Pada fraksi berpotensi bioavailable mengalami penurunan sebesar 18,18 mg/kg (29,56%). Kandungan logam Cu dalam selada dari tanah yang ditambahkan pupuk kompos lebih rendah yaitu 23,02 ± 1,69 mg/kg dibandingkan dengan selada dari tanah tanpa pupuk kompos yaitu 25,23 ± 0,14 mg/kg. ABSTRACT: The aims of this research are to determine the total content of Cu metal in lettuce and its effect of adding compost to the bioavailability of agricultural soil from the fields in Candi Kuning, Bedugul. The method used is four-stage extraction (fractionation) and absorbance measurement using atomic absorption spectrophotometer (AAS). The concentration was determined using calibration curve method. The results of this research showed that the additional of compost in agricultural soil could reduce Cu concentrations in the bioavailability fraction approximately 0.70-2.06 mg/kg (21.25-59.57%). In the potentially bioavailability fraction, it decreased by 18.18 mg/kg (29.56%). The total content of Cu metal in lettuce from soil with compost was 23.02 ± 1.69 mg/kg it was lower compared to lettuce from soil without compost which was 25.23 ± 0.14 mg/kg.
STUDI FOTODEGRADASI METILEN BIRU OLEH ZnO/KULIT JERUK DENGAN PENYINARAN LAMPU UV-LED Eva Umi Latifah; Aulia Dewi Rosanti; Fahmi Hidayat
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry)
Publisher : Graduate Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Penelitian ini bertujuan untuk mengkaji pengaruh variasi waktu kontak terhadap persentase fotodegradasi metilen biru menggunakan sampel ZnO dan ZnO/Kulit Jeruk (KJ) serta mengkaji model kinetika adsorpsi yang sesuai untuk menggambarkan proses adsorpsi yang terjadi. Material ZnO dan ZnO/KJ disintesis menggunakan metode impregnasi basah dan aktivitas fotokatalitik diamati dibawah Sinar UV LED (365 nm) dengan variasi waktu kontak 0 - 120 menit. Sampel ZnO dan ZnO/KJ dikarakterisasi dengan FTIR, SEM, XRD, DR-UV, dan BET. Kinetika adsorpsi dianalisa menggunakan model orde satu semu dan orde dua semu. Hasil penelitian menunjukkan bahwa presentase degradasi meningkat seiring dengan peningkatan waktu penyinaran. Nilai presentase degradasi terbaik untuk penghilangan metilen biru adalah material ZnO/KJ dengan presentase degradasi terbaik sebesar 67 % pada mode gelap dan 94 % pada mode terang. Sedangkan ZnO hanya mampu mendegradai metilen biru sebesar 46 % pada mode gelap dan 74 % pada mode terang. Berdasarkan data laju adsorpsi menunjukkan bahwa proses adsorpsi ZnO dan ZnO/KJ mengikuti model orde dua semu sehingga dapat disimpulkan bahwa proses adsorpsi yang terjadi melibatkan proses adsorpsi kimia. . ABSTRACT : This study aims to examine the effect of contact time variations on photodegradation percentage of methylene blue using ZnO and ZnO/KJ (orange peel) catalysts as well as to examine the adsorption kinetic models that suitable to describe the adsorption process occured. The ZnO/KJ catalysts was synthesized using the wet impregnation method and the photocatalytic activity was observed under UV LED light (365 nm) with a contact time variation of 0 - 120 minutes. The ZnO and ZnO/KJ catalysts were characterized by FTIR, SEM, XRD, DR-UV, and BET. The adsorption kinetics were obtained using pseudo-first-order and pseudo-second-order models. The results showed that the degradation percentage increased with increasing irradiation time. The highest degradation percentage values of methylene blue using ZnO/KJ catalyst are of 67% in dark mode and of 94% in light mode, respectively. Meanwhile, the ZnO was only able to degrade methylene blue by 46% in dark mode and 74% in light mode. Based on the adsorption rate data, the adsorption process of ZnO and ZnO/KJ follows a pseudo-second order model, so it can be concluded that the adsorption process occured involves a chemisorption process

Page 17 of 19 | Total Record : 184

 15   16   17   18   19 

Filter by Year

2013 2024


Reset
Filter By Issues
All Issue Vol 12 No 1 (2024): Cakra Kimia (Indonesia E-Journal of Applied Chemistry) Vol 11 No 2 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 11 No 1 (2023): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 10 No 2 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 10 No 1 (2022): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 9 No 2 (2021): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 9 No 1 (2021): Cakra Kimia (Indonesian E-Journal of Applied Chemistry) Vol 8 No 2 (2020): Volume 8, Nomor 2, 2020 Vol 8 No 1 (2020): Volume 8, Nomor 1, 2020 Vol 7 No 2 (2019): volume 7, Nomor 2, 2019 Vol 7 No 1 (2019): Volume 7, Nomor 1, 2019 Vol 6 No 2 (2018): Volume 6, Nomor 2, 2018 Vol 6 No 1 (2018): Volume 6, Nomor 1, 2018 Vol 5 No 2 (2017) Vol 5 No 1 (2017) Vol 4 No 2 (2016) Vol 4 No 1 (2016) Vol 3 No 3 (2015) Vol 3 No 2 (2015) Vol 2 No 2 (2014) Vol 2 No 1 (2014) Volume 1, No. 2, 2013 Volume 1, No. 1, 2013 More Issue