Claim Missing Document
Check
Articles

Found 5 Documents
Search

A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis S, Sumartono
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.325 KB)

Abstract

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecularprobe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genomeand a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probelabeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with themolecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detectionstarter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequenceGGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNAtarget by dot blot method.Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization
PELATIHAN DAN PENDAMPINGAN DALAM MENUMBUHKAN RASA PERCAYA DIRI MELALUI LATIHAN DASAR KEPEMIPINAN DAN PUBLIC SPEAKING BAGI PENGURUS OSIS SMAN 3 TAMBUN SELATAN, BEKASI Astuti, Hani; Dewi, Nita Komala; S, Sumartono
Jurnal Terapan Abdimas Vol 8, No 1 (2023)
Publisher : UNIVERSITAS PGRI MADIUN

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25273/jta.v8i1.14263

Abstract

Abstract. The purpose of the PKM activity is to provide training and knowledge/insights about growing self-confidence with public speaking techniques and basic leadership training for OSIS management members at SMAN 3 Tambun Selatan, Bekasi. The reason the team provides PKM in the form of training and mentoring to partners, where partners experience several problems, namely many of the OSIS management members do not yet have a leadership spirit, especially in organizing and their self-confidence is still lacking when speaking in public. The offer is to provide training to partners for 2 days with the implementation method, namely the preparation stage, implementation stage, and evaluation stage. The three stages were carried out starting from Wednesday – Friday, June 15 – June 17, 2022 in the SMAN 3 Tambun Selatan hall and attended by 30 participants. The presence of an enthusiastic attitude from the participants is one of the targets of the activity. In addition, the results of the PKM are the increased ability of the participants to speak in public and the increased knowledge of participants about organization. Abstrak. Tujuan kegiatan PKM adalah memberikan pelatihan dan ilmu/wawasan mengenai menumbuhkan kepercayaan diri dengan teknik public speaking dan latihan dasar kepemimpinan bagi anggota pengurus OSIS SMAN 3 Tambun Selatan, Bekasi. Alasan tim memberikan PKM dalam bentuk pelatihan dan pendampingan kepada mitra, dimana mitra mengalami beberapa permsalahan yakni banyak dari anggota pengurus OSIS yang belum memiliki jiwa kepemimpinan khususnya dalam beroganisasi dan rasa percaya diri yang dimiliki masih kurang apabila berbicara di depan umum.Untuk itu, solusi yang ditawarkan yakni memberikan pelatihan kepada mitra selama 2 hari dengan metode pelaksanaan yakni tahapan persiapan, tahapan pelaksanaan, dan tahapan evaluasi. Ketiga tahapan tersebut dilaksanakan mulai dari hari Rabu – Jumat, 15 Juni – 17 Juni 2022 di Aula SMAN 3 Tambun Selatan dan diikuti oleh 30 orang peserta. Adanya sikap antusias dari peserta merupakan salah satu dari target kegaiatan selain itu, hasil dari PKM yakni meningkatnya kemampuan dari peserta untuk berbicara di depan umum dan meningkatnya pengetahuan peserta mengenai keorganisasian.
Information Technology Audit in Optimizing Resources and Utilization of Financial Information Systems Anggraini, Fransisca Dyah; S, Sumartono; Rusman, Hedar
TECHNOVATE: Journal of Information Technology and Strategic Innovation Management Vol. 1 No. 1 (2024): January 2024
Publisher : PT.KARYA GEMAH RIPAH

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.52432/technovate.1.1.2024.35-44

Abstract

The utilization of financial information systems in companies has become part of the application of information technology, but there are challenges in the complexity and risk of its implementation. This study uses a qualitative and quantitative approach with the information technology audit method and the COBIT 5 framework. The research objectives analyzed the Maturity Level in the EDM, APO, BAI, and DSS domains using the COBIT 5 framework. The results showed a GAP between Current Maturity and Expected Maturity in each domain. The EDM domain has an average Current Maturity of 3.80, at the Manage and Measurable level, with the highest GAP in IT utilization. The APO domain has an average Current Maturity of 4.00, also at the Manage and Measurable level, with the highest GAP in portfolio management and IT quality services. The BAI domain has an average Current Maturity of 3.96, at the Manage and Measurable level, with the highest GAP in managing IT service availability and capacity. The DSS domain has an average Current Maturity of 4.40, at the Manage and Measurable level, with the highest GAP in the implementation of IT operating procedures. The research conclusions highlight areas of improvement involving information system management, information system portfolio management, and the effectiveness of operating financial reporting information system utilization procedures to improve maturity levels and optimize the utilization of the company's financial information systems.
Study of Tissue Cyst Formation Time of Toxoplasma gondii in Mice Hanafiah, M.; Nurcahyo, Wisnu; S, Sumartono
Jurnal Kedokteran Hewan Vol 1, No 2 (2007): September
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v1i2.3132

Abstract

The purpose of the research was to study a tissue cyst formation time Toxoplasma gondiiexperimentally. A number of 84 mice were divided randomly into four groups. Each group consisted of 21mice. The mice of the group I were infected with 101, II with 102 and III with 10 tachyzoites respectivelyintraperitoneally, whereas the group IV as a control (not infected with tachyzoites). All infected micewere treated with sulfadiazine, 15 mg/mouse per oral diluted in drinking water, for 5 days. On first untiltwenty first day after treatment one mouse of each group was necropsied. Liver, lymph, kidney, lung,heart, brain, or diaphragm muscle were then taken for histological preparations. Data on tissue cystformation time was analysed descriptively. The research revealed that innoculation with tachyzoites 103cyst could be found on day 14th after infection of liver, 102 cyst was found on the 6 day of liver, in day7th in heart and brain on day 10th of after infection, 103 cyst was found on day 4th inheart and brain in day 7thth in liver, day 6 after infection, while in the control dosage there is no formation similar to cyst found.Keywords: cyst, tissue, T. gondii, mice th1
DETECTION OF SAG1 AND BAG1 Toxoplasma gondii DNA PROBES LABELLED WITH DIGOXIGENIN-11-dUTP Apsari, Ida Ayu Pasti; Artama, Wayan Tunas; s, Sumartono; Damriyasa, I Made
Jurnal Kedokteran Hewan Vol 7, No 1 (2013): March
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v7i1.579

Abstract

The objective of this research was to detect a minimum concentration of the probes that could be used for dot blot hybridization analysis. Themethod required labeled DNA probes. In this study a non-radioactive label of Digoxigenin-11-dUTP was used for labeling the Sag1 and the Bag1 of Toxoplasma gondii DNA probe. Labeling method for the probes was done according to the random primed labeling technique. The result showed that 0.67 pg/l Sag1 probe and 0.58 pg/l Bag1 probe could be detected by anti-Dig-antibody. It could be concluded that 0.67 pg/l Sag1 probe and 0.58 pg/l Bag1 probe could be used to diagnose toxoplasmosis by dot blot hybridization method.