cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
,
INDONESIA
Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology
ISSN : 20895690     EISSN : 24069272     DOI : -
Squalen publishes original and innovative research to provide readers with the latest research, knowledge, emerging technologies, postharvest, processing and preservation, food safety and environment, biotechnology and bio-discovery of marine and fisheries. The key focus of the research should be on marine and fishery and the manuscript should include a fundamental discussion of the research findings and their significance. Manuscripts that simply report data without providing a detailed interpretation of the results are unlikely to be accepted for publication in the journal.
Arjuna Subject : -
Articles 363 Documents
Health Risk Assessment Related to Total Mercury (THg) Concentration in Clam (Periglypta crispata) from Kepulauan Seribu Regency, Indonesia Triyoni Purbonegoro; Suratno Suratno
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (544.755 KB) | DOI: 10.15578/squalen.v15i1.435

Abstract

Mercury (Hg) contaminated seafood can cause severe health problems if it is consumed regularly. Mercury is very dangerous for humans because it can damage or reduce the function of the central nervous system, blood composition, lungs, kidneys, and other vital organs. This metal can also cause birth defects in newly born babies. The objectives of this study were to determine the concentration of total mercury (THg) in clams (Periglypta crispata) collected from Kepulauan Seribu Regency and the safe amount per week for consuming them. The safe amount (kg per week) to consume this clam was calculated by the Maximum Tolerable Intake (MTI) method. Our results showed that the average concentration of THg in the clams was 0.18±0.07  mg/kg wet weight. Among the analyzed organs, THg accumulation was highest in the digestive tract tissues. The clams were still safe to be consumed by humans since the THg concentration in these clams has not exceeded the maximum limit of heavy metal in seafood (0.5 mg/kg) set by the government of Indonesia. The safe amount to consume these clams was 0.53 kg per week, to avoid the adverse effect of Hg to human health.
Characteristics and Use of Peptones from Catfish (Clarias gariepinus) and Pangas Catfish (Pangasius pangasius) Heads as Bacterial Growth Media Dwi Setijawati; Abdul Aziz Jaziri; Hefti Salis Yufidasari; Mohammad Dwi Pratomo; Dian Wahyu Wardani; Dinda Ersyah; Nurul Huda
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (775.789 KB) | DOI: 10.15578/squalen.v15i1.437

Abstract

Peptone is a hydrolysate product rich in amino acids, and it is uncoagulated at high temperature. Commercial peptone produced from land animals cannot be declared as acceptable in terms of lawfulness due to religious concerns. Catfish (Clarias gariepinus) and pangas catfish (Pangasius pangasius) are important species for the fish processing industry in Indonesia. The filleting process resulted in value by-products. The fish head as the by-products can be utilized as a main raw material for higher economic value products, such as peptone. The aim of this study was to characterize peptones extracted from the heads of catfish and pangas catfish with different acid conditions. The characteristics of chemical composition, yield, color parameter, solubility, amino acid content, bacterial growth rate and biomass production were observed. The catfish peptone (CFP) and pangas catfish peptone (PCP) obtained with different acid conditions showed high protein content in the range of 84.35% to 90.80% (P0.05). The yields of CFP and PCP were significantly different (P0.05) and varied between 4.75% and 5.66%. The solubility of treated peptones varied between 98.03% and 99.52%, and the peptones were rich in glycine, glutamic acid, proline and leucine. Bacterial growth test showed that both CFP and PCP had better growth rates compared to the commercial peptone tested in this study. In addition, the biomass production with peptone from catfish and pangas catfish was higher than that with the commercial product (P0.05). This research proposed that catfish and pangas catfish heads could be developed as an alternative source for peptone production.
Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study Stalis Norma Ethica; Sri Darmawati; Sri Sinto Dewi; Nurrahman Nurrahman; Ayu Rahmawati Sulistyaningtyas
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (576.394 KB) | DOI: 10.15578/squalen.v15i1.416

Abstract

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.
Front Cover Squalen Bulletin Vol. 15 No. 1 Tahun 2020 bulletin Squalen
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (463.241 KB) | DOI: 10.15578/squalen.v15i1.468

Abstract

Effect of Alginate and Polyethylene Glycol Addition on Physical and Mechanical Characteristics of k-Carrageenan-based Edible Film Giyatmi, Giyatmi; Poetri, Tika Annisa Eka; Irianto, Hari Eko; Fransiska, Dina; Agusman, Agusman
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (516.391 KB) | DOI: 10.15578/squalen.v15i1.418

Abstract

Waste disposal problems have attracted scientists around the world to explore the use of renewable resources to produce biodegradable films and coatings. Indonesia has diverse renewable resources of biopolymers that originated from seaweeds such as carrageenan, agar, and alginate. Carrageenan is considered as a potential biopolymer for edible film manufacture due to its characteristic range. This study aimed to develop carrageenan-based edible film using alginate and polyethylene glycol as plasticizers. Edible film made from k-carrageenan with the addition of alginate and polyethylene glycol (PEG) as plasticizers was tested for its mechanical properties, water vapor transmission rate (WVTR) and water solubility.  Blending k-carrageenan with alginate (0%, 0.25%, 0.5%, 0.75%, and 1.0% w/v) increased tensile strength, thickness, and water solubility, but reduced elongation at break, WVTR, and moisture content. The addition of PEG (1%, 2%, and 3% w/v) reduced tensile strength and water solubility, but increased elongation at break, thickness, and moisture content. This study recommended that the best carrageenan-based edible film was obtained from a formula using 1% alginate (w/v) and 1% PEG (w/v).
Growth Rate and Histamine Production of Klebsiella sp. CK02 Isolated from Skipjack Tuna Compared with Morganella morganii ATCC 25830 at Various Incubation Temperatures Dityanawarman, Aldino; Dewi, Indun Puspita; Ratnawati, Susana Endah; Ekantari, Nurfitri; Tamplin, Mark
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (611.845 KB) | DOI: 10.15578/squalen.v15i1.441

Abstract

One of an important quality parameter in tuna is the level of histamine content. The contamination of histamine in tuna is mainly due to the activity of histidine decarboxylase produced by the bacteria. A rapid growth of histamine producing bacteria is correlated with the practice of temperature abuse during handling. This study aimed to develop predictive growth modeling of two histamine-producing bacteria in the function of temperature. The growth and histamine production of Klebsiella sp. CK02 and Morganella morganii ATCC 25830 at various temperatures were measured in tryptic soy broth histidine (TSBH) and tuna fish infusion broth (TFIB) growth media. Broths were incubated at 4°C and 15°C for 7 days, and at 30°C and 40°C for 24 hours. The Baranyi and Roberts model was used with DMFit to determine primary growth kinectics, and the Ratkowsky square root model to describe bacterial growth rate as a function of temperature. Histamine production was enumerated by the apparent yield factor (pYhis/CFU) value. Growth rate increased with temperature, with a maximum rate at 40°C for Klebsiella sp. CK02 (0.740 log CFU/h) and M. morganii (0.578  log CFU/h). The Tmin for Klebsiella sp. CK02 in TFIB was -8.9°C, indicating better survival in low storage temperature, compare to M. morganii ATCC 25830. In addition, Klebsiella sp. CK02 produced a lower pYhis/CFU at 15 and 30°C compared to M. morganii ATCC 25830. 
Preface Squalen Bulletin Vol. 15 No. 1 Tahun 2020 bulletin, squalen
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (35.605 KB) | DOI: 10.15578/squalen.v15i1.471

Abstract

Back Cover Squalen Bulletin Vol. 15 No. 1 Tahun 2020 bulletin Squalen
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (463.235 KB) | DOI: 10.15578/squalen.v15i1.470

Abstract

Preface Squalen Bulletin Vol. 15 No. 3 Tahun 2020 Squalen Bulletin
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 3 (2020): December 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15578/squalen.v15i3.522

Abstract

Front Cover Squalen Bulletin Vol. 15 No. 3 Tahun 2020 Squalen, bulletin
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 3 (2020): December 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15578/squalen.v15i3.520

Abstract


Filter by Year

2006 2025


Filter By Issues
All Issue Vol 20, No 3 (2025): December 2025 Vol 20, No 2 (2025): August 2025 Vol 20, No 1 (2025): May 2025 Vol 19, No 3 (2024): December 2024 Vol 19, No 2 (2024): August 2024 Vol 19, No 1 (2024): May 2024 Vol 18, No 3 (2023): December 2023 Vol 18, No 2 (2023): August 2023 Vol 18, No 1 (2023): May 2023 Vol 17, No 3 (2022): December 2022 Vol 17, No 2 (2022): August 2022 Vol 17, No 1 (2022): May 2022 Vol 16, No 3 (2021): December 2021 Vol 16, No 2 (2021): August 2021 Vol 16, No 1 (2021): May 2021 Vol 15, No 3 (2020): December 2020 Vol 15, No 2 (2020): August 2020 Vol 15, No 1 (2020): May 2020 Vol 14, No 3 (2019): December 2019 Vol 14, No 2 (2019): August 2019 Vol 14, No 1 (2019): May 2019 Vol 13, No 3 (2018): December 2018 Vol 13, No 2 (2018): August 2018 Vol 13, No 1 (2018): May 2018 Vol 12, No 3 (2017): December 2017 Vol 12, No 3 (2017): December 2017 Vol 12, No 2 (2017): August 2017 Vol 12, No 2 (2017): August 2017 Vol 12, No 1 (2017): May 2017 Vol 12, No 1 (2017): May 2017 Vol 11, No 3 (2016): December 2016 Vol 11, No 2 (2016): August 2016 Vol 11, No 2 (2016): August 2016 Vol 11, No 1 (2016): May 2016 Vol 10, No 3 (2015): December 2015 Vol 10, No 2 (2015): August 2015 Vol 10, No 2 (2015): August 2015 Vol 10, No 1 (2015): May 2015 Vol 10, No 1 (2015): May 2015 Vol 9, No 3 (2014): December 2014 Vol 9, No 2 (2014): August 2014 Vol 9, No 1 (2014): May 2014 Vol 9, No 1 (2014): May 2014 Vol 8, No 3 (2013): December 2013 Vol 8, No 2 (2013): August 2013 Vol 8, No 1 (2013): May 2013 Vol 8, No 1 (2013): May 2013 Vol 7, No 3 (2012): December 2012 Vol 7, No 3 (2012): December 2012 Vol 7, No 2 (2012): August 2012 Vol 7, No 1 (2012): May 2012 Vol 6, No 3 (2011): December 2011 Vol 6, No 2 (2011): August 2011 Vol 6, No 1 (2011): May 2011 Vol 6, No 1 (2011): May 2011 Vol 5, No 3 (2010): December 2010 Vol 5, No 2 (2010): August 2010 Vol 5, No 1 (2010): May 2010 Vol 5, No 1 (2010): May 2010 Vol 4, No 3 (2009): December 2009 Vol 4, No 3 (2009): December 2009 Vol 4, No 2 (2009): August 2009 Vol 4, No 2 (2009): August 2009 Vol 4, No 1 (2009): May 2009 Vol 3, No 2 (2008): December 2008 Vol 3, No 1 (2008): June 2008 Vol 2, No 2 (2007): December 2007 Vol 2, No 2 (2007): December 2007 Vol 1, No 1 (2006): December 2006 Article in Press More Issue