cover
Contact Name
Andika Aliviameita
Contact Email
medicra@umsida.ac.id
Phone
+6287888333053
Journal Mail Official
medicra@umsida.ac.id
Editorial Address
Jl. Mojopahit No.666B, Sidoarjo, Jawa Timur
Location
Kab. sidoarjo,
Jawa timur
INDONESIA
Medicra (Journal of Medical Laboratory Science/Technology)
ISSN : 25807730     EISSN : 25807730     DOI : https://doi.org/10.21070/medicra
Core Subject : Health,
Focus : to facilitate scholar, researchers, and lecturers for publishing the original articles of review articles. Scope : Medicra publishes research articles in the field of “medical laboratory (science/technology)” with the following scope: Clinic Chemical Hematology Microbiology Parasitology Immunology Food and beverage analysis Chemical Molecular Diagnostics Toxicology Cytology Histology Epidemiology Laboratory Management Laboratory Quality Control
Articles 5 Documents
Search results for , issue "Vol. 3 No. 2 (2020): December" : 5 Documents clear
Effectiveness of Ethanolic Extract of Aloe Vera Leaves against Staphylococcus aureus: Efektivitas Ekstrak Etanol Daun Lidah Buaya (Aloe vera) terhadap Staphylococcus aureus Permatasari, Viki Ayu Intan; Nurjanah, Mutia Hariani; Widodo, Wimbuh Tri
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.760

Abstract

Since long ago Indonesia used nutritious plants as traditional medicines. Various types of plants in Indonesia can be used as alternative ingredients, one of which is aloe vera. Aloe vera contains saponin and anthraquinone, so aloe vera leaves function as antiseptic and antibacteria. Staphylococcus aureus is a gram-positive coccus bacteria. This bacterium is often found as a normal germ flora in humans. Staphylococcus aureus can cause infections in humans and animals. This study aims to determine the effect of ethanolic extract of Aloe vera leaves in inhibiting Staphylococcus aureus by using maceration extract method. The concentrations used were 20%, 40%, 60%, 80% and 100% with positive control (Erytromycin) and negative control (aquades). The inhibitory zone analysis is done using the table method. Test of ethanol extract of Aloe vera leaves in inhibiting Staphylococcus aureus produced inhibition zones at concentrations of 60%, 80% and 100% with average diameter of 6.94 mm, 6.22 mm and 9.5 mm. The conclusion of this research is the ethanolic extract of Aloe vera leaves can inhibit Staphylococcus aureus in high concentrations
Correlation Between Personal Hygiene And Hemoglobin Levels On Typhoid Fever Suspect Patients At Lirboyo General Hospital: Hubungan Personal Hygiene Dengan Kadar Hemoglobin Pada Penderita Suspek Demam Tifoid Di Rumah Sakit Umum Lirboyo Farodis, Indana; Purnadianti, Mely
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.800

Abstract

Personal Hygiene is an effort made by individuals in maintaining personal hygiene to avoid disease. Personal Hygiene is closely related to typhoid fever, because its transmission can be through food and drinks which are contaminated with Salmonella typhi. WHO and UNICEF ​​on 2015 ranked Indonesia as the second worst sanitation country in the world after India. One of the laboratory tests which is used to observe anemia levels and polycythaemia is hemoglobin degree. The purpose of this study was to analyze the correlation between personal hygiene and hemoglobin levels on typhoid fever suspect patients at Lirboyo General Hospital. The research method used analytic survey with Cross Sectional Study approach and purposive sampling used as the sampling technique with 38 respondents. The results of the study mostly have worst personal hygiene quality of 31 people (81.6%) while respondents have good personal hygiene quality of 7 people (18.4%) and the of hemoglobin category on patients stated normal in 29 people (76.3%) while patients who have abnormal hemoglobin category in 9 people (23.7%). Based on statistical tests on personal hygiene by hemoglobin showed 0.876 p-value and > 0.05 sig value Conclusion which indicated no correlation between personal hygiene and hemoglobin on typhoid fever suspect at Lirboyo General Hospital.
In-Vitro Sunscreen Activity of White Turi Leaf Acetone (Sesbania grandiflora (L.) Pers.) Extract: Aktivitas Tabir Surya Ekstrak Aseton Daun Turi Putih (Sesbania grandiflora (L.) Pers.) Secara In-Vitro Siroj, Muhammad Said Agil; Rohmah, Jamilatur
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.852

Abstract

Sunscreens are cosmetic preparations that protect the skin from exposure to UV radiation resulting in erythema , skin burning , aging and skin cancer. Leaf of Sesbania grandiflora (L.) Pers. contain phenolic compounds such as tannins and flavonoids which act as photoprotective . This research method is experimental with quantitative descriptive analysis. The purpose of research is to know the value of SPF, transmission erythema (% Te) and pigmentation (% Tp) of acetone extracts of Sesbania grandiflora (L.) Pers. using Spectrophotometry UV -Vis at a wavelength of 280-400 nm with intervals of 5 nm. This study variations in extract concentration were made 100, 200, 400, 600, 800 and 1000 ppm. The results showed the SPF value of extracts of all concentrations in a row was 1.9 ( minimum ); 3.6 ( minimum ); 15.9 ( moderate ); 56.3 ( high ); 133.9 ( high ); and 136.6 ( high ). The %Te value is 400 ppm ( fast tanning ), 600 ppm ( regular suntan ) and 1000 ppm ( extra protection ). The value of %Tp at all extract concentrations is included in the category total block .
Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples: Identifikasi Gen ND1 Mitokondria Pembawa Sifat Diabetes Mellitus Tipe 2 Melalui Sampel Darah Amin, Hindah Sabrina; Mushlih, Miftahul
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Abstract

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
Relationship between Blood Pressure and Urine Protein in Preeclampsia at Prima Husada Hospital Sidoarjo : Hubungan Tekanan Darah Dengan Protein Urine Pada Kejadian Preeklamsia Di RSU Prima Husada Sidoarjo Santoso, Andreas Putro Ragil; Masruroh, Nur; Amalia, Ikke Nanda; Santy, Wesiana Heris
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.1081

Abstract

The problems related to pregnancy and childbirth including maternal and infant mortality rates can’t be removed from another causative factors that arise, one of the second cause from maternal mortality rates is preeclampsia, which is a specific disorder of hypertension caused by pregnancy at gestational age of more than 20 weeks with proteinuria and rarely occurs before 20 weeks gestational except if any kidney or trophoblastic disease. Hypertension and proteinuria to be a symptoms that often appears in preeclampsia diagnose. The relationship between of risk factor occur preeclampsia, that is blood pressure and protein urine which is the important indicator for enforcement of preeclampsia. The purpose of researchis analyze the relationship between of blood pressure and protein urine levels on the incidence of preeclampsia. The type of this research is analytic observational. Sample of this research is pregnant mother with preeclampsia in RSU Prima Husada Sidoarjo. The results use the Correlation Pearson test showed that p value for the systolic blood pressure is 0.791 and the diastolic blood pressure is 0.268, this is shows that blood pressure isn’t related with protein urine.

Page 1 of 1 | Total Record : 5