cover
Contact Name
Andika Aliviameita
Contact Email
medicra@umsida.ac.id
Phone
+6287888333053
Journal Mail Official
medicra@umsida.ac.id
Editorial Address
Jl. Mojopahit No.666B, Sidoarjo, Jawa Timur
Location
Kab. sidoarjo,
Jawa timur
INDONESIA
Medicra (Journal of Medical Laboratory Science/Technology)
ISSN : 25807730     EISSN : 25807730     DOI : https://doi.org/10.21070/medicra
Core Subject : Health,
Focus : to facilitate scholar, researchers, and lecturers for publishing the original articles of review articles. Scope : Medicra publishes research articles in the field of “medical laboratory (science/technology)” with the following scope: Clinic Chemical Hematology Microbiology Parasitology Immunology Food and beverage analysis Chemical Molecular Diagnostics Toxicology Cytology Histology Epidemiology Laboratory Management Laboratory Quality Control
Articles 121 Documents
Quick Diagnostics Of New Infectious Coronavirus Boboev Muhammadayubkhon Murodkhonovich; Ramazonova Shahzoda
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 1 (2020): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i1.402

Abstract

The emergence in December 2019 of diseases caused by the new coronavirus (2019-nCoV) posed difficult challenges for healthcare professionals and doctors related to the rapid diagnosis and clinical management of patients with this infection.
The Detection of TB Lungs with Microscopic and the Rapid Molecular Test Methods Fifi Isti Tamtyas; Chylen Setiyo Rini
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 1 (2020): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i1.650

Abstract

Mycobacterium tuberculosis is a cause of tuberculosis (TB ) disease. In this research Mycobacterium tuberculosis can be detected using the Microscopic and Real-Time PCR. This research aims are to know the difference in the results of the examination Mycobacterium tuberculosis with microscopic method and Real-Time PCR. This research used an experimental research design and was tested using the Chi Square test. This results showed at significant difference (p=0.000) detection of pulmonary TB disease by microscopic and Real-Time PCR methods
Relationship of HbA1c with Fasting Blood Glucose on Diagnostic Values and Lifestyle in Type II Diabetes Mellitus Patients Rahayu Anggraini; Ima Nadatein; Puji Astuti
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 1 (2020): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i1.651

Abstract

Early diagnosis of DM (Diabetes Mellitus) is very important in reducing complications. HbA1c has been recommended as a diagnosis of diabetes in the guidelines for clinical practice as a determination of type 2 diabetes in 2011 by WHO, but is there a significant relationship between HBA1c and fasting blood glucose levels (GDP) in a person after being diagnosed with Diabetes Mellitus. In this study, the relationship between HbA1c and GDP levels was assessed through observational cross-sectional analytic based studies. The research method uses a large sample selected through the GDP test (> 125 mg / dl) of 17 people (5 men and 12 women). Statistical analysis of the test of the relationship between the HbA1c results and GDP with the Pearson Correlation, Crosstabs, and independent T test to determine the relationship of sex with GDP and HBA1c. The results of the study, there was a significant relationship between levels of GDP with HBA1c with p = 0.002, where the incidence of GDP (> 125 mg / dl) in men was 17.7% and women were 52.9%, while the results of HBA1c (> 6.5 %) in men 23.5% and women 52.9%. In conclusion, the results of HBA1c (> 6.5%) can be used for diagnosis of DM, whereas the level of GDP is only to know that people with diabetes have changed their lifestyle or not, and it is found that women are more easily change lifestyles than men, due to GDP results (<125 mg / dl) of 11.8% higher than the HBA1c yield (<6.5%) of 5.9%.
Characterization of Chitosan Nanoparticles from Milkfish Scales as an Alternative Preservatives of Fresh Pangas Catfish (Pangasius hypopthalmus) Zurrotul Ilmiyah; Jamilatur Rohmah
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 1 (2020): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i1.654

Abstract

Fish is a commodities that are very easy to decompose (Highly Perishable), therefore made efforts to extend the shelf life of fish by using preservatives. Preservatives that are not harmful to health are chitosan nanoparticles. The aim of this research are to know the characterization of chitosan nanoparticles from milkfish scales and their effect as fresh pangas catfish preservative by using concentration variation 1%, 2%, 3%, 4%, and 5% and optimization of storage time 12, 24, 36 , 48, 60, and 72 hours. Design in this research is experimental laboratory. Characterization of chitosan nanoparticles using FT-IT and SEM-EDX. While the effect of fresh pangas catfish preservation on chitosan nanoparticles is based on water, ash, protein, and ALT parameters. The results obtained on the characterization of chitosan nanoparticles on the identification of functional groups (FT-IR) showed absorption bands of OH groups at a peak 3450,99 cm-1, the CN snow absorption band was seen at the peak 2360,44 cm-1, the amine band of NH amine at the peak of 1639,20 cm-1 and the crystalline alcohol CO uptake band was observed at a peak of 1096,33 cm-1. The characterization results of SEM-EDX chitosan nanoparticles are round but clumped and clearly visible particle size changes. The experimental results were analyzed with two-way ANOVA statistic showing a significant effect between concentration variation and length of storage time to extend the durability of fresh pangas catfish. The best results of chitosan nanoparticles on fresh pangas catfish is at 5% concentrations at 72 hours of storage time with water value 16,4%, ash value 0,04%, protein value 0,04%, and ALT value 4,0 x 105cfu/g.
The Effect Of Lemon (Citrus limon) Juice on Serum BUN And Creatiinin Levels In Hyperuricemia Rattus norvegicus Siti Nofiani Mufida; Puspitasari Puspitasari
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 1 (2020): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i1.655

Abstract

Hyperuricemia is a condition of increasing levels of uric acid in blood serum above normal values. Citrus limon contains flavonoids which have the ability to regenerate kidney function and play a role in reducing oxidative stress. The purpose of this study is to determine the effect of lemon juice (Citrus limon) on serum BUN levels and creatinine in Rattus norvegicus rats that experienced hyperuricemia. The research design used is quantitative analysis using experimental methods. This study used 24 Rattus norvegicus rats were divided into 6 groups. group 1 as normal control, group 2 as hyperuricemia control, group 3 with chicken liver juice and allopurinol 10 mg / g BB, group 4 with chicken liver juice and lemon juice 0,9 ml / 200g BB, group 5 with giving chicken liver juice and lemon juice a dose of 1.8 ml / 200 g BB, group 6 with the administration of chicken liver juice and lemon juice with a dose of 3.6 ml / 200 g BB orally. White mice are taken blood for BUN (Blood Urea Nitrogen) and creatinine. Based on the results of the One Way ANOVA statistical test, there was an effect of Citrus limon juice on BUN levels in group 5 with a value of 18,425 mg/dl, while at creatinine levels which affected Citrus limon juice in group 5 of 0,250 mg/dl.
Effectiveness of Ethanolic Extract of Aloe Vera Leaves against Staphylococcus aureus: Efektivitas Ekstrak Etanol Daun Lidah Buaya (Aloe vera) terhadap Staphylococcus aureus Permatasari, Viki Ayu Intan; Nurjanah, Mutia Hariani; Widodo, Wimbuh Tri
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.760

Abstract

Since long ago Indonesia used nutritious plants as traditional medicines. Various types of plants in Indonesia can be used as alternative ingredients, one of which is aloe vera. Aloe vera contains saponin and anthraquinone, so aloe vera leaves function as antiseptic and antibacteria. Staphylococcus aureus is a gram-positive coccus bacteria. This bacterium is often found as a normal germ flora in humans. Staphylococcus aureus can cause infections in humans and animals. This study aims to determine the effect of ethanolic extract of Aloe vera leaves in inhibiting Staphylococcus aureus by using maceration extract method. The concentrations used were 20%, 40%, 60%, 80% and 100% with positive control (Erytromycin) and negative control (aquades). The inhibitory zone analysis is done using the table method. Test of ethanol extract of Aloe vera leaves in inhibiting Staphylococcus aureus produced inhibition zones at concentrations of 60%, 80% and 100% with average diameter of 6.94 mm, 6.22 mm and 9.5 mm. The conclusion of this research is the ethanolic extract of Aloe vera leaves can inhibit Staphylococcus aureus in high concentrations
Correlation Between Personal Hygiene And Hemoglobin Levels On Typhoid Fever Suspect Patients At Lirboyo General Hospital: Hubungan Personal Hygiene Dengan Kadar Hemoglobin Pada Penderita Suspek Demam Tifoid Di Rumah Sakit Umum Lirboyo Farodis, Indana; Purnadianti, Mely
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.800

Abstract

Personal Hygiene is an effort made by individuals in maintaining personal hygiene to avoid disease. Personal Hygiene is closely related to typhoid fever, because its transmission can be through food and drinks which are contaminated with Salmonella typhi. WHO and UNICEF ​​on 2015 ranked Indonesia as the second worst sanitation country in the world after India. One of the laboratory tests which is used to observe anemia levels and polycythaemia is hemoglobin degree. The purpose of this study was to analyze the correlation between personal hygiene and hemoglobin levels on typhoid fever suspect patients at Lirboyo General Hospital. The research method used analytic survey with Cross Sectional Study approach and purposive sampling used as the sampling technique with 38 respondents. The results of the study mostly have worst personal hygiene quality of 31 people (81.6%) while respondents have good personal hygiene quality of 7 people (18.4%) and the of hemoglobin category on patients stated normal in 29 people (76.3%) while patients who have abnormal hemoglobin category in 9 people (23.7%). Based on statistical tests on personal hygiene by hemoglobin showed 0.876 p-value and > 0.05 sig value Conclusion which indicated no correlation between personal hygiene and hemoglobin on typhoid fever suspect at Lirboyo General Hospital.
In-Vitro Sunscreen Activity of White Turi Leaf Acetone (Sesbania grandiflora (L.) Pers.) Extract: Aktivitas Tabir Surya Ekstrak Aseton Daun Turi Putih (Sesbania grandiflora (L.) Pers.) Secara In-Vitro Siroj, Muhammad Said Agil; Rohmah, Jamilatur
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.852

Abstract

Sunscreens are cosmetic preparations that protect the skin from exposure to UV radiation resulting in erythema , skin burning , aging and skin cancer. Leaf of Sesbania grandiflora (L.) Pers. contain phenolic compounds such as tannins and flavonoids which act as photoprotective . This research method is experimental with quantitative descriptive analysis. The purpose of research is to know the value of SPF, transmission erythema (% Te) and pigmentation (% Tp) of acetone extracts of Sesbania grandiflora (L.) Pers. using Spectrophotometry UV -Vis at a wavelength of 280-400 nm with intervals of 5 nm. This study variations in extract concentration were made 100, 200, 400, 600, 800 and 1000 ppm. The results showed the SPF value of extracts of all concentrations in a row was 1.9 ( minimum ); 3.6 ( minimum ); 15.9 ( moderate ); 56.3 ( high ); 133.9 ( high ); and 136.6 ( high ). The %Te value is 400 ppm ( fast tanning ), 600 ppm ( regular suntan ) and 1000 ppm ( extra protection ). The value of %Tp at all extract concentrations is included in the category total block .
Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples: Identifikasi Gen ND1 Mitokondria Pembawa Sifat Diabetes Mellitus Tipe 2 Melalui Sampel Darah Amin, Hindah Sabrina; Mushlih, Miftahul
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Abstract

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
Lethal Efficacy of Banana Leaves Extract (Musa paradisiaca L.) Against Aedes aegypti Larvae: Daya Bunuh Ekstrak Daun Pisang (Musa paradisiaca L.) Terhadap Larva Aedes aegypti Karima, Wihdatul; Ardiansyah, Syahrul
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 4 No. 1 (2021): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v4i1.881

Abstract

Indonesia has a potential to be exposed to the threat of dengue hemorrhagic fever with the point vector, the Aedes aegypti mosquito, so development need to be stopped. The use of synthetic larvicides in eradicating mosquito larvae can cause environmental pollution. To reduce it, an alternative is needed using plant larvacides with banana leaf. Banana leaves are obtained from Candi Sidoarjo. Ethanol extract of banana leaf contains tannin compounds, alkaloids, terpenoids, saponins, and flavonoids which can be used as larvicides. This research was conducted to determine the toxic effects of banana leaf extract (Musa paradisiaca L.) on the larvae of Aedes aegypti mosquito mortality. This research was conducted using the post test only the control group design with 6 treatment groups including control (aquades) and banana leaf extract concentrations of 1000 ppm, 2000 ppm, 3000 ppm, 4000 ppm, 5000 ppm. This study used third instar larvae, each test group countaining 20 larvae with 4 repetitions. That obtained were analyzed using data and probit tests. The results of this study that banana leaf extract has a toxic effect on Aedes aegypti mosquito larvae with LC50 at a concentration of 4638 ppm.

Page 1 of 13 | Total Record : 121