cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Rijal Satria
Contact Email
rijalsatria@fmipa.unp.ac.id
Phone
+6282284574790
Journal Mail Official
rijalsatria@fmipa.unp.ac.id
Editorial Address
Jalan Prof. Dr. Hamka, Air Tawar Padang, Sumatera Barat.
Location
Kota padang,
Sumatera barat
INDONESIA
Jurnal Serambi Biologi
Published by Universitas Negeri Padang
ISSN : -     EISSN : 27222829     DOI : -
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Immunology & microbiology
Artikel ilmiah yang dipublikasi adalah artikel dalam bidang biologi (biodiversitas, biosistematika, ekologi, fisiologi, genetika dan bioteknologi, biokimia) yang meliputi semua bentuk mahluk hidup mulai dari mikroba, fungi, tumbuhan, hewan, manusia dan virus
Arjuna Subject : Biokimia, Genetika dan Biologi Molekuler - Biologi Perkembangan
Articles 187 Documents
 10   11   12   13   14 
Ethnobotanical Study Of the Zingiberaceae Family in Local Community Life in Padang Bubus Village, Bonjol District, Pasaman Regency, West Sumatera. Rahmi Hidayah Putri _
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Abstract The community of Padang Bubus is a local community that lives in the hills, Bonjol Subdistrict, Pasaman Regency. The plant utilization knowledge has been inherent in their societal culture as medicine, food, building materials and as also ritual material. The deterioration in tranditional treatment knowledge for younger generations is feared by loss of information regarding the utilization of herbs as medicine. This research aimed to investigate the use of Zingiberaceae for traditional medicine in Padang Bubus Village, Bonjol Subdistrict, Pasaman Regency. This research had been carried out from Januari to Februari 2023. The result showed that 8 Zingiberaceae species used by local people in Padang Bubus village were Curcuma domestica, Curcuma xanthorrizha, Costus spesiosus, Alpinia galanga, Kaemferia galanga, Zingiber officinale, Etlingera elatior and Amomum compactum. Botanical studies show that this family is more dominant in herbaceous stature with pseudo stems and can be distinguished between species by the color of the rhizomes. Ethnomedicine studies show that this family is more likely to treat internal medicine. Ethnoecological studies show that this family has been widely cultivated rather than wild, but has not been tested as a natural herbicide and pesticide. Keyword : Ethnobotany, Padang Bubus, ethnomedicine, ethnoecology, Zingiberaceae.
Review Of Indonesia’s Butterfly Inventory Articels Nela Berliani; Rijal Satria
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Kupu-kupu Rhopalocera merupakan organisme yang memiliki morfologi Yang indah dan berperan penting di alam. Namun jenis kupu-kupu tersebut masih belum Banyak diketahui, apalagi penyebarannya cukup banyak di Indonesia. Metode penelitian yang digunakan pada penulisan ini adalah dengan studi literatur menganalisis atau mereview sekitar 30 jurnal yang ada dibuat persebaranb famili dalam bentuk diagram lingkaran.. Review artikel ilmiah ini bertujuan untuk mengetahui apa saja jenis kupu kupu yang tersebar di wilayah seluruh Indonesia dan apa saja spesies yang mendominasi di masing-masing habitat. Berdasarkan hasil didapatkan bahwa ada 6 Famili yang bisa ditemukan dari jurnal yang didapat spesies yang paling mendominasi adalah spesies dari Family Nymphalidae. Family Nymphalidae merupakan Family terbesar dengan lebih dari 6000 jenis spesies diseluruh dunia. Keywords: Inventarisasi Kupu-Kupu, Rhopalocera, Indonesia
Geminivirus Disease (PepYLCV) in Chili (Capsicum sp.) Caused by Whitefly (Bemisia tabaci): Penyakit Geminivirus (PepYLCV) pada Tanaman Cabai (Capsicum sp.) yang Disebabkan oleh Hama Kutu Kebul (Bemisia tabaci) Rahmat Albar Payobadar
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Cabai merupakan salah satu tanaman holtikultura yang sangat tinggi produksinya di Indonesia. Namun, tanaman ini banyak yang bersifat lemah dan rentan terhadap berbagai penyakit. Salah satunya adalah penyakit Geminivirus disebabkan oleh virus Begomovirus, yang dibawa oleh kutu kebul (Bemisia tabaci) sehingga menyebabkan penyakit keriting daun kuning pada cabai yang dikenal dengan Pepper Yellow Leaf Curl Virus (PepYLCV). Tujuan dalam penelitian ini adalah supaya mendapatkan hasil perbandingan terhadap pengendalian Begomovirus yang menyerang tanaman cabai dan mampu menemukan wawasan untuk mencari solusi yang efektif terhadap pengendaliannya. Pengendalian terhadap Begomovirus dapat dilakukan dengan cara menekan penyebaran penyakit begomovirus, seperti penggunaan mulsa dan penyemprotan inseksitida kimia. Pemakaian nanopestisida minyak serai dan ektrak murni minyak serai lebih efektif daripada pemakaian pestisida kimia biasa. Keywords : Bemista tabaci,, Geminivirus, kutu kebul, tanaman cabai, virus Begomovirus
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Antipyretic Plants in Kasik Putih Timur Hamlet Cubadak Air Utara Village Pariaman Utara District Pariaman City Delvia Suarman
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The use of plants as medicine has been carried out by Indonesian people for a long time, one of which is using plants to reduce body temperature or as antipyretics. The content of Flavonoid compounds in plants is efficacious for lowering body temperature. This study aims to determine the types of plants that can be used by the community as antipyretic drugs. The research method used is explorative which is qualitative in nature. Data collection was carried out through interviews with respondents. Respondents who were used to find out the types of plants as antipyretics were people who had knowledge and still used plants to treat diseases. Identification of plants is done by using related books and journals. Data analysis was carried out descriptively on the types of plants that have antipyretic properties. Based on the research results, it was found that 7 types of plants have antipyretic properties used by the people of East Kasik Putih Hamlet, Cubadak Air Utara Village, North Pariaman District, Pariaman City. The plants used are Annona muricata L. (Soursop), Kalanchoe pinnata L. (Sidinding), Jatropha curcas L. (Jirak), Hibiscus rosasinensis (Bungo Rayo), Abelmoschus manihot L. (Paracetamol), Nephelium Lappaceum L. (Rambutan) , Peronema canescens Jack (Sungkai). Key words Plants, Antipyretics, Kasik Putih Timur Hamlet
Ethnobothany of Medicinal Plants Utilized by the People of Nagari Campago District V Koto Kampung Dalam Padang Pariaman Regency Audela Irma Oktavira
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Indonesia is a country that has high biodiversity including plants. Plants are often used to fulfill human needs, including physical needs, such as traditional medicines for body health. Plants that have medicinal properties are used to relieve pain, kill pathogens and are able to increase endurance. The aim of this study is to find out the species of medicinal plants dan the benefits, the parts of plant used and the method of processing them based on the knowledge of the people of Nagari Campago District V Koto Kampung Dalam Padang Pariaman Regency. Data collected through semi- structured interviews with 20 selected respondents who had knowledge more about the use of plants as traditional medicine. Based on the results of the study, 30 types of medicinal plants from 21 families were used by the people of Nagari Campago. The most parts of plant used are leaves (60%) and the method of processing is mostly done by boiling (67%) in the singular form and consumed by drinking (90%).
Vegetation Structure of Bukit Barisan Protected Forest I Sub DAS Lubuk Paraku Lubuk Kilangan District Padang City Ramadhani, Suci; Leilani Eka Putri, Irma; Satria, Rijal; Kardiman, Reki
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.234

Abstract

Vegetation plays an important role in overcoming hydrological processes in an area, including protected forest areas. Changes in vegetation cover in protected forests will affect the water flow of a watershed ecosystem. However, there is still a lack of information about the vegetation structure of the Bukit Barisan I protected forest, so it is important to do research to find out the vegetation that makes up the Bukit Barisan I protected forest, the Lubuk Paraku Sub-watershed in Lubuk Kilangan District, Padang City. The research was conducted from November 2022 - March 2023. This type of research is descriptive using a survey method. For field data collection, the single plot method was used in 2 areas, the natural forest area and the forest adjacent to the garden. In each area, 3 single plot plots were made, 2 x 2 m plots for undergrowth and seedlings, 5 x 5 m for saplings, 10 x 10 m for poles, and 20 x 20 m for trees. Found at the seedling stage 145 individuals from 20 families, saplings 51 individuals from 10 families, pole stage 29 individuals from 10 families and tree stage 48 individuals from 12 families. The most individuals at the seedling level are included in the Araceae family, the most individual saplings and trees are included in the Moraceae family, the most individual pole stages are included in the euphorbiaceae family. Keywords: structure, protected forest, Lubuk Paraku watershed
Efektivitas Ekstrak Daun Ketapang (Terminalia catappa L.) Dalam Menghambat Pertumbuhan Colletotrichum capsici Penyebab Penyakit Antraknosa Pada Buah Cabai Pasca Panen Bahari, Krisma Bahari
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i3.235

Abstract

Jamur Colletotrichum capsici merupakan salah satu organisme pengganggu tanaman yang menyebabkan penyakit antraknosa pada buah cabai merah. Kerusakan akibat dari penyakit antraknosa ini selanjutnya akan berkembang selama proses penyimpanan (pasca panen). Gejala buah pasca panen diawali dengan bercak hitam kecokelatan kemudian berkembang menjadi busuk lunak. Pada umumnya petani menggunakan fungsida sintesis untuk pengendalian penyakit antraknosa yang dapat menimbulkan dampak negatif. Untuk mencegah dampak negatif tersebut penggunaan fungsida nabati diharapkan dapat menggantikan fungsida sintesis. . Dengan demikian, diperlukan pilihan lain yaitu fungisida alami, salah satunya ekstrak daun Terminalia cattapa L. dalam menghambat pertumbuhan C. capsici. Tujuan penelitian untuk mengetahui Efektivitas Ekstrak Daun Ketapang (Terminalia catappa L.) dalam Menghambat Pertumbuhan Colletotrichum capsici Penyakit Antraknosa pada Buah Cabai Pasca Panen. Penelitian ini dilaksanakan dari bulan November 2022-Maret 2023 di Laboratorium Penelitian Departemen Biologi FMIPA UNP. Penelitian ini merupakan penelitian eksperimen yang terdiri dari 5 perlakuan dan 3 ulangan dengan pemberian ekstrak daun ketapang konsentrasi 0% (kontrol), 70%, 80%, 90% dan 100%. Analisis data dengan ANOVA dan uji lanjut DMRT pada taraf 5%, aktivitas antimikroba dianalisis secara deskriptif. Hasil penelitian menunjukkan bahwa ekstrak daun ketapang mampu menghambat pertumbuhan C. capsicum Konsentrasi 70% dan 80% diklasifikasikan sebagai lemah dan konsentrasi 90% dan 100% tergolong kuat.
Inventory of Mammal Species Using Camera Trap in Pondok Parian Nagari Forest, Lunang, Pesisir Selatan Regency, West Sumatra Tassya Putri; Reki Kardiman; Fitra Nugraha
Jurnal Serambi Biologi Vol. 8 No. 2 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Mammal inventory is a survey activity to find mammal species that exist in a certain area at a certain time and point. The existence of mammals in a forest area helps restore forest conditions through their role as natural predators and seeds dispersing. Nagari Forest is one of the efforts to maintain the existence of forests and biodiversity that have ecological, economic, socials and cultural benefits. The aim of this study was to determine the types of mammals found in Pondok Parian Nagari Forest, Lunang based on the results of camera trap recordings. This research is descriptive study, conducted from July 2022 to January 2023. Located in Pondok Parian Nagari Forest, Lunang, West Sumatra. Data collection using the camera trap method. The data obtained was analyzed and then arranged into the table consisting of orders, famili and species. The camera trap succeeded in documenting 19 species of mammals belonging to 14 families and 6 orders. Those identified species were Tapirus indicus, Capricornis sumatraensis, Muntiacus muntjac, Tragulus napu, Cuon alpinus, Neofelis diardi, Prionailurus bengalensis, Pardofelis marmorata, Helarctos malayanus, Martes flavigula, Hemigalus derbyanus, Paguma larvata, Viverra tangalunga, Arctictis binturong, Hystrix brachyura, Macaca namestrina, Presbytis melalophos, Macaca fascicularis, Echinosorex gymnure.
Produksi Serasah di Kawasan Hutan Lindung Bukit Barisan I Sub DAS Lubuk Paraku Kecamatan Lubuk Kilangan Kota Padang Zahari, Dinda Putri
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.237

Abstract

Produksi serasah adalah komponen yang penting dalam memindahkan bahan organik dari vegetasi ke dalam tanah. Tujuan penelitian ini untuk mengetahui jumlah produksi serasah di kawasan hutan lindung bukit barisan I Sub DAS Lubuk Paraku Kecamatan Lubuk Kilangan Kota padang. Penelitian ini dilaksanakan dari bulan Desember 2022 - April 2023. Jenis penelitian ini adalah penelitian deskriptif dengan menggunakan metode survey. Dimana untuk pengambilan data menggunakan teknik purposive random sampling. Data diambil di 2 area, area 1 merupakan hutan alami, dan area 2 merupakan area berbatasan dengan parak. Pengambilan serasah menggunakan 6 buah jaring penampung (litter trap) dengan ukuran 1 x 1 meter. Setiap stasiun diletakan secara acak 3 buah jaring penampung serasah (litter trap) dan diambil 1 x 15 hari selama dua bulan penelitian. Hasil penelitian menunjukan produksi serasah yang paling tinggi yaitu pada area 1 di hutan alami didapatkan total rata-rata produksi serasah hutan lindung bukit barisan I sub DAS lubuk paraku kecamatan lubuk kilangan kota padang sebesar 21,45 gr/m2/hari, kemudian disusul oleh produksi serasah di area berbatasan dengan parak sebesar 15,86 gr/m2/hari.

Page 12 of 19 | Total Record : 187

 10   11   12   13   14 

Filter by Year

2021 2024


Reset
Filter By Issues
All Issue Vol. 9 No. 3 (2024): Jurnal Serambi Biologi Vol. 9 No. 2 (2024): Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi Vol. 8 No. 2 (2023): Jurnal Serambi Biologi Vol. 8 No. 1 (2023): Jurnal Serambi Biologi Vol. 7 No. 4 (2022): Jurnal Serambi Biologi Vol. 7 No. 3 (2022): Jurnal Serambi Biologi Vol. 7 No. 2 (2022): Jurnal Serambi Biologi Vol. 7 No. 1 (2022): Jurnal Serambi Biologi Vol. 6 No. 2 (2021): Jurnal Serambi Biologi More Issue