cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
suranto
Contact Email
editors@smujo.id
Phone
-
Journal Mail Official
editors@smujo.id
Editorial Address
unsjournals@gmail.com
Location
Kota surakarta,
Jawa tengah
INDONESIA
Biodiversitas Journal of Biological Diversity
Published by Universitas Sebelas Maret
ISSN : 1412033X     EISSN : 20854722     DOI : https://doi.org/10.13057/biodiv/d230231
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
The Biodiversitas Journal was first published in 2000 by the Department of Biology, FMNS, Universitas Sebelas Maret, Surakarta, Indonesia, then in 2006 it was co-published by the Society for Indonesian Biodiversity and that department; since 2017 it was also hosted by Smujo. From 2003-2012 it was accredited by DGHE, Ministry of Education, R.I., since 2014 was indexed by Scopus, where DOAJ and Google Scholar was indexed first.
Arjuna Subject : Biokimia, Genetika dan Biologi Molekuler - Biokimia, Genetika dan Biologi Molekuler (Lain-Lain)
Articles 6,269 Documents
 248   249   250   251   252 
Identification of fermentative bacteria on local microorganisms of golden snail (Pomacea canaliculata Lamarck, 1822) YULIANA RETNOWATI; Abubakar Sidik Katili
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220231

Abstract

Abstract. Retnowati Y, Katili AS. 2021. Identification of fermentative bacteria on local microorganisms of golden snail (Pomacea canaliculate Lamarck, 1822). Biodiversitas 22: 778-784. Local Microorganisms (LMo) is a fermented liquid containing various microorganisms that potentially act as decomposers and bio-fertilizer. P. canaliculata is one of the rice pests that is a basic ingredient of LMo because of its high protein content. The objective of this study was to determine the types of fermentative bacteria on Local Microorganisms of P. canaliculata. The fermentation of LMo was conducted for 0, 7, 14, and 21 days. Microbial population was determined at 7-day intervals based on the TPC method. Characterization and identification based on polyphasic taxonomy including macroscopic and microscopic morphological characters., Molecular identification was based on 16S rRNA gene sequences. The results showed that LMo of P. canaliculata had a low degree of acidity and tended to decrease during the incubation period, from pH 5.3 to 4.0. Bacterial population tends to increase at 0-14 fermentation days and decreases after 21 days. The isolation results showed that the 3 bacterial isolates namely BFPc-01, BFPc-02, and BFPc-03 were isolated based on morphological differences. The morphological characters of BFPc-01 was milky white color colony, Gram-negative, coccus; BFPc-02 isolate was pink, colony color, Gram-negative, coccus; and BFPc-03 isolate was yellow color colony, bacillus, Gram-positive. The results of molecular characterization based on the 16s rRNA gene sequence showed that BFPc-01 isolate similar to Klebsiella pneumoniae MT604895.1 (99.04%), BFPc-02 isolate closely related to Serratia sp. (100%), and BFPc-03 isolate similar to Microbacterium  sp. (100%).
Predicting potential impacts of climate change on the geographical distribution of mountainous selaginellas in Java, Indonesia AHMAD DWI SETYAWAN; JATNA SUPRIATNA; NISYAWATI NISYAWATI; ILYAS NURSAMSI; SUTARNO SUTARNO; SUGIYARTO SUGIYARTO; SUNARTO SUNARTO; PRAKASH PRADAN; SUGENG BUDIHARTA; ARI PITOYO; SAPTA SUHARDONO; PRABANG SETYONO; MUHAMMAD INDRAWAN
Biodiversitas Journal of Biological Diversity Vol. 21 No. 10 (2020)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d211053

Abstract

Abstract. Setyawan AD, Supriatna J, Nisyawati, Nursamsi I, Sutarno, Sugiyarto, Sunarto, Pradan P, Budiharta S, Pitoyo A, Suhardono S, Setyono P, Indrawan M. 2020. Predicting potential impacts of climate change on the geographical distribution of mountainous selaginellas in Java, Indonesia. Biodiversitas 21: 4866-4877. Selaginella is a genus of non-flowering plant that requires water as a medium for fertilization, as such, it prefers mountainous areas with high level of humidity. Such unique ecosystem of Selaginella is available in some parts of Java Island, Indonesia, especially in highland areas with altitude of more than 1,000 meters above sea level. However, most mountainous areas in Java are likely to be affected by climate change due to global warming, threatening the habitat and sustainability of Selaginella. This study aimed to investigate the impacts of climate change on the geographical distribution of Selaginella opaca Warb. and Selaginella remotifolia Spring. In doing so, we predicted the suitable habitats of both species using Species Distribution Model (SDM) tool of MaxEnt under present climate conditions and future conditions under four climate change scenarios. Species occurrence data were obtained from fieldworks conducted in 2007-2014 across Java Island (283 points: 144 and 139 points for S. opaca and S. remotifolia, respectively) and combined with secondary data from Global Biodiversity Information Facility (GBIF) (52 points: 35 and 17 points for S. opaca and S. remotifolia, respectively), and this dataset was used to model present geographical distribution using environmental and bioclimatic variables. Then, future distribution was predicted under four climate change scenarios: i.e. RCP (Representative Carbon Pathways) 2.6, RCP 4.5, RCP 6.0, and RCP 8.5 in three different time periods (2030, 2050, and 2080). The results of the models showed that the extent of suitable habitats of S. opaca and S. remotifolia will be reduced between 1.8-11.4% due to changes in climatic condition, and in the areas with high level of habitat suitability, including Mount Sumbing, Mount Sindoro and Mount Dieng (Dieng Plateau), the reduction can reach up to 60%. This study adds another context of evidence to understand the potential impacts of climate change on biodiversity, especially on climate-sensitive species, such as Selaginella, in climate-risk regions like mountainous areas of Java Island.
The structure and composition of macrozoobenthos community in varying water qualities in Kalibaru Waters, Bengkulu, Indonesia Lilisti LILISTI; Zamdial ZAMDIAL; Dede Hartono; Bieng Brata; Marulak Simarmata
Biodiversitas Journal of Biological Diversity Vol. 22 No. 1 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220115

Abstract

Abstract. Lilisti, Zamdial, Hartono D, Brata B, Simarmata M. 2021. The structure and composition of macrozoobenthos community in varying water qualities in Kalibaru Waters, Bengkulu, Indonesia. Biodiversitas 22: 106-112. Various human activities affect the quality of the aquatic ecosystem that can be assessed by measuring the physical, chemical, and biological parameters of the waters and sediments. This is the case of Kalibaru Waters, Bengkulu, Indonesia which shows changes in the estuary and marine ecosystems due to the cut-off of the main river around the area for the development of roads and bridges. The objective of this study was to analyze the quality of the waters and substrate, and the structure of the macrozoobenthos community as a bioindicator at the Kalibaru Waters. A survey was carried out in four stations, which was purposively selected based on human activities around the waters. Data collected included the physical and chemical parameters, and the diversity and density of macrozoobenthos species. The density of macrozoobenthos species was analyzed for summed dominance ratio (SDR), diversity (H'), homogeneity (E), and dominance (D) indices. The results showed that the physical and chemical parameters of Kalibaru Waters were acceptable for aquatic life, however, the oil contents at two stations exceeded the ecological threshold. Analysis of the macrozoobenthos community as a bioindicator for water quality found that the diversity and homogeneity indices were at a medium level indicating an unstable community, while the dominant index remained low indicating that none of the species was dominant in the Kalibaru Waters. This information is needed as a reference for the government of Bengkulu Province to make appropriate policies and management decisions to maintain the quality of the aquatic ecosystem in Kalibaru Waters.
Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties Reny Herawati; ALNOPRI ALNOPRI; MASDAR MASDAR; MARULAK SIMARMATA; SIPRIYADI SIPRIYADI; MIMI SUTRAWATI
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220232

Abstract

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse.  Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants.  The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI.  Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively.  Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively.  This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.
Anthocyanin profile of Syzygium oleana young leaves and fruits using triple quadrupole mass spectrometer: Identification of a new peonidin Tuty Anggraini; Daimon Syukri; Thammawong Manasikan; Kohei Nakano
Biodiversitas Journal of Biological Diversity Vol. 21 No. 12 (2020)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d211254

Abstract

Abstract. Anggraini T, Syukri D, Manasikan TW, Nakano K. 2020. Anthocyanin profile of Syzygium oleana young leaves and fruits using triple quadrupole mass spectrometer: Identification of a new peonidin. Biodiversitas 21: 5893-5900. Anthocyanin is pigment present in many red, blue and purple colored plants that can be used as stable food-safe colorings and also offer health benefits as antioxidants. Syzygium oleana, with its dark purple fruit and red leaves, is one hitherto unexplored source of anthocyanin. This study is the first to establish the anthocyanin profile of S. oleana leaves and fruit exploiting the speed and accuracy of Multiple Reaction Monitoring (MRM) with a triple quadrupole mass spectrometer. The anthocyanin compounds in the leaves and fruit of S. oleana were found to be derivatives of agliconpeonidin, cyanidin derivative, delphinidin. It was found that while both leaves and fruit of S. oleana contain the anthocyanin precursors cyanidin, delphinidin, petunidin, and peonidin. Fruit contains the anthocyanin malvidin and a large amount of petunidin not present in the leaves. In detail: anthocyanin found in S. oleana leaves were Cyanidin 3-galactoside, cyanidin with m/z 611, Delphinidin 3-O-?-D-glucopyranoside, and unknown peonidin. Anthocyanin in S. oleana fruits was cyanidin with m/z 449.1, delphinidin 3-O-?-D-glucopyranoside, petunidin with m/z 476, Malvidin 3-O-?-D-glucopyranoside, and an unknown peonidin. Fruit could be a better anthocyanin source and more effective as colorant than leaves, while leaves contain a stronger as yet unidentified antioxidant.
Impact of highway on vertebrate roadkill in Nam Nao National Park, Thailand Wuttisak Kummoo; Jiraporn Teampanpong; Pantiya Utsa; Paanwaris Paansri; Warong Suksavate; Prateep Duengkae; Sutin Prompat
Biodiversitas Journal of Biological Diversity Vol. 21 No. 11 (2020)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d211163

Abstract

Abstract. Kummoo W, Teampanpong J, Paansri P, Suksavate W, Utsa P, Duengkae P, Prompat S. 2020. Impact of highway on vertebrate roadkill in Nam Nao National Park, Thailand. Biodiversitas 21: 5540-5550. Roads lead to biodiversity loss, primarily through wildlife collisions. This phenomenon is widespread, despite limited attention in Thailand. To reduce road mortality, the roadkilled species and their distributions along the road become a significant component for designing management strategies. We surveyed vertebrate mortality covering 44 kilometers of Highway 12, passing through Nam Nao Nation Park in Phetchabun Province of Thailand for 34 replicates between August 2018 and July 2019. We recorded 1,389 carcasses of 578 amphibians, 540 reptiles, 190 mammals and 81 birds. The rate of wildlife-vehicle collisions (WVCs) was 1.089 ± 0.823 carcasses-km-1day-1, comprised mostly of amphibians. The distribution pattern of WVCs was arranged in spatial clusters. Five wildlife collision hotspots for four taxa groups were identified. Overall, the WVC presence was positively associated with vegetation types but negatively associated with distance to the forest edge, the presence of road barriers and the number of road lane. Concurrently, the numbers of roadkill incidents were positively associated with amphibians more than other vertebrate groups, the night time and number of daily vehicles. Our results suggest that WVC rates on HW12 vary among taxonomic groups, temporal scales and environmental factors. It highlights key hotspots where mitigation strategies should be implemented for biodiversity conservation.
Short Communication: Plant diversity utilization and land cover composition in the Subak Jatiluwih, Bali, Indonesia Sutomo Sutomo; Rajif Iryadi; I Dewa Putu Darma; I Putu Agus Hendra Wibawa; Ayyu Rahayu; Siti Fatimah Hanum; Syamsul Rizal; Ledya Novamizanti; Jangkung Raharjo
Biodiversitas Journal of Biological Diversity Vol. 22 No. 3 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220345

Abstract

Abstract. Sutomo, Iryadi R, Darma ID, Wibawa IPAH, Rahayu A, Hanum SF, Rizal S, Novamizanti L, Raharjo J. 2021. Short Communication: Plant diversity utilization, and land cover composition in the Subak Jatiluwih, Bali, Indonesia. Biodiversitas 22: 1424-1432. Subak is water management or irrigation system for paddy fields in Bali Island and it has been assigned as a UNESCO’s World Heritage Site. At a landscape level, it comprises several components which are forests, terraced paddy landscape, rice fields, villages and temples. Subak in Jatiluwih Village, Tabanan Regency depicts an area characterized by its natural appearance in the form of a vast rice valley with a dike in stratum following its natural contours (frequent terraces). This paper aimed to explore plant diversity in various vegetations around Subak Jatiluwih as well as their usage in the daily living of the local community. We also explore the potential application of drone for classifying the landscape patterns of the Subak.Vegetation sampling to record plant diversity was done using purposive sampling, and drone or Unmanned Aerial Vehicle (UAV) was used to map the Subak Jatiluwih landscape. The potential usage of each species was obtained through interview with key respondents, and the level of usage of each species was analyzed using the BIV (Benefit Index Value). Tegalan area shows the highest number plant diversity in Subak Jatiluwih area. Furthermore, there are four species of plants that have the highest BIV namely: Cocos nucifera L., Psidium guajava L., Areca catechu L. and Musa × paradisiaca L.. Various plant uses by the locals include for animal feed, building, ceremony, craft, and food and medicinal purposes. The landscape in Subak Jatiluwih is dominated the vast valley of rice fields that has strata following its natural contours. These conditions provide opportunities to applied the conservation strategy based on cultural and custom values.
Short Communication: Relationship between interferon-tau level (IFN- ?) and embryo mortality incident in Aceh cattle JULI MELIA; Tongku Siregar; LUTHFY ALFAHMI; HUSNURRIZAL HUSNURRIZAL; HENDRA SAUMAR; MUKHTAR MUKHTAR; NELLITA MEUTIA; BUDIANTO PANJAITAN; TEUKU ARMANSYAH
Biodiversitas Journal of Biological Diversity Vol. 21 No. 12 (2020)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d211236

Abstract

Abstract. Melia J, Siregar TN, Alfahmi L, Husnurrizal, Saumar H, Mukhtar, Meutia N, Panjaitan B, Armansyah T. 2020. Short Communication: Relationship between interferon-tau level (IFN- ?) and embryo mortality incident in Aceh cattle. Biodiversitas 21: 5758-5762. The purpose of this research is to determine the relationship between interferon-tau level (IFN-?) and the incidence of embryo mortality in Aceh cattle from the Province of Aceh, Indonesia. Data were obtained from four Aceh cattle, aged 3-5 years and body weight of 150-250 kg. The cattle were clinically healthy, with at least two regular reproduction cycles, and a pregnant status after estrous synchronization and artificial insemination. This process was carried out on a 10-day interval using the intramuscular administration of prostaglandin F2 alpha (PGF2?) hormone, at a dose of 25 mg, with double injection pattern. The blood samples were collected from the jugular vein on day 14 to 18 post-insemination for the assessment of IFN-? concentration, which was measured using the enzyme linked-immunoassay (ELISA) method and the bovine interferon ELISA kit (Cusabio Technology LLC AII, USA). In addition, the transrectal ultrasonography method was used to test the pregnancy and embryo mortality of the cattle on the 25th day. The examination was repeated every 10 days until day 55. The IFN-? concentrations of pregnant cows against those with embryo mortality on the 14th, 15th, 16th, 17th, and 18th day, were 12.066±8.222 vs 17.853±11.126, 12.983±3.491 vs 20.503±3.858, 12.193±4.535 vs 16.458±8.065, 10.143±5.370 vs 17.604±1.888, and 12.767±7.753 vs 15.096±6.955 pg/mL, respectively. Therefore, the embryo mortality in Aceh cattle is not related to IFN-?.
DNA intensity and genetic diversity of oil palm (Elaeis guineensis) to determine an elite low lipase line Nina Unzila Angkat; LUTHFI AZIZ MAHMUD SIREGAR; Mohammad Basyuni; Dadang Afandi; INDRA SYAHPUTRA
Biodiversitas Journal of Biological Diversity Vol. 22 No. 2 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220245

Abstract

Abstract. Angkat NU, Siregar LAM, Basyuni M, Afandi D, Syahputra I. 2021. DNA intensity and genetic diversity of oil palm (Elaeis guineensis) to determine an elite low lipase line. Biodiversitas 22: 900-905. The acidification of palm oil due to lipase activity in the mesocarp is assessed under genetic control. Three molecular markers have been established to gauge the lipase gene in oil palm. Lower lipase activity is desired for good quality edible oil. This study aims to identify the genetic diversity by screening groups/families to determine an elite low lipase genotype of oil palm. Genetic diversity and population structure of 15 groups of oil palm were investigated by using three specific markers with GenAlex 6.502 software. Results show that the Polymorphic Informative Content (PIC) value of markers was around 0,985-0,993, which indicates that these markers are effective in determining the diversity of lipase activity in oil palm. Analysis of molecular variance (AMOVA) revealed that genetic diversity varies within individuals (54%), among individuals (31%), and among population (15%). The value of number of alleles (Na), number of effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), and number of allele migration (Nm) indicate that the genetic diversity in this population is relatively low. Phylogenetic analysis identified two main groups as high lipase and low lipase activity groups based on DNA intensity.
Diversity of macro fungus across three altitudinal ranges in Lore Lindu National Park, Central Sulawesi, Indonesia and their utilization by local residents YUSRAN YUSRAN; ERNIWATI ERNIWATI; DEWI WAHYUNI; RAMADHANIL RAMADHANIL; AKHMAD KHUMAIDI
Biodiversitas Journal of Biological Diversity Vol. 22 No. 1 (2021)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d220126

Abstract

Abstract. Yusran Y, Erniwati E, Wahyuni D, Ramadhanil R, Khumaidi A. 2021. Diversity of macro fungus across three altitudinal ranges in Lore Lindu National Park, Central Sulawesi, Indonesia and their utilization by local residents. Biodiversitas 22: 199-210. A large amount of biodiversity research has been carried out in Lore Lindu National Park, a major biodiversity center in Central Sulawesi, Indonesia, but none have investigated the biodiversity of macrofungi and their traditional utilization. Therefore, this study aimed to explore the diversity of macro fungus in Lore Lindu National Park, and to identify their potential uses as food sources and medicinal uses by the local residents living around Lore Lindu National Park. Exploration of macrofungus species in Lore Lindu National Park was done at three locations representing three altitudinal ranges: (i) <500 m above sea level (asl); (ii) 500–1500 m asl; and >1500 m asl. Ten plots were placed in two major lines with a 100 m distance between plots in each sampling location. All macrofungi within the observation plots were then documented and identified. Ethnomycological studies were done by asking questionnaire to selective respondents, group discussion, and pictorial presentation studies to random respondents in five villages located in the buffer zone of the national park area. This study found 172 species (including unidentified species/sp.) from 33 families of macro fungus in Lore Lindu National Park in which 159 of them belong to the Basidiomycota division, while 13 of them were of the Ascomycota division. Our results also showed varying diversity of macrofungus at different altitudes. At the elevation of <500 m asl, as many 77 species were found, while 117 and 142 species were found at the elevation of 500-1500 and >1500 m asl, respectively. Marasmius spp and Hygrocybe spp were the most abundant genera, and nine species (i.e. Schizophyllum commune, Termytomyces sp, Auricularia auricular-judge, Auricularia sp., Pleurotus ostreatus, Ganoderma lucidum, Xylaria sp., Agaricus sp. dan Lentinus sajor-caju) were utilized as a food source and in traditional medicine by the residents around the national park area.

Page 250 of 627 | Total Record : 6269

 248   249   250   251   252 

Filter by Year

2000 2026


Reset
Filter By Issues
All Issue Vol. 27 No. 6 (2026) Vol. 27 No. 5 (2026) Vol. 27 No. 4 (2026) Vol. 27 No. 3 (2026) Vol. 27 No. 2 (2026) Vol. 27 No. 1 (2026) Vol. 26 No. 12 (2025) Vol. 26 No. 11 (2025) Vol. 26 No. 10 (2025) Vol. 26 No. 9 (2025) Vol. 26 No. 8 (2025) Vol. 26 No. 7 (2025) Vol. 26 No. 6 (2025) Vol. 26 No. 5 (2025) Vol. 26 No. 4 (2025) Vol. 26 No. 3 (2025) Vol. 26 No. 2 (2025) Vol. 26 No. 1 (2025) Vol. 25 No. 12 (2024) Vol. 25 No. 11 (2024) Vol. 25 No. 10 (2024) Vol. 25 No. 9 (2024) Vol. 25 No. 8 (2024) Vol. 25 No. 7 (2024) Vol. 25 No. 6 (2024) Vol. 25 No. 5 (2024) Vol. 25 No. 4 (2024) Vol. 25 No. 3 (2024) Vol. 25 No. 2 (2024) Vol. 25 No. 1 (2024) Vol. 24 No. 12 (2023) Vol. 24 No. 11 (2023) Vol. 24 No. 10 (2023) Vol. 24 No. 9 (2023) Vol. 24 No. 8 (2023) Vol. 24 No. 7 (2023) Vol. 24 No. 6 (2023) Vol. 24 No. 5 (2023) Vol. 24 No. 4 (2023) Vol. 24 No. 3 (2023) Vol. 24 No. 2 (2023) Vol. 24 No. 1 (2023) Vol. 23 No. 12 (2022) Vol. 23 No. 11 (2022) Vol. 23 No. 10 (2022) Vol. 23 No. 9 (2022) Vol. 23 No. 8 (2022) Vol. 23 No. 7 (2022) Vol. 23 No. 6 (2022) Vol. 23 No. 5 (2022) Vol. 23 No. 4 (2022) Vol. 23 No. 3 (2022) Vol. 23 No. 2 (2022) Vol. 23 No. 1 (2022) Vol. 22 No. 12 (2021) Vol. 22 No. 11 (2021) Vol. 22 No. 10 (2021) Vol. 22 No. 9 (2021) Vol. 22 No. 8 (2021) Vol. 22 No. 7 (2021) Vol. 22 No. 6 (2021) Vol. 22 No. 5 (2021) Vol. 22 No. 4 (2021) Vol. 22 No. 3 (2021) Vol. 22 No. 2 (2021) Vol. 22 No. 1 (2021) Vol. 21 No. 12 (2020) Vol. 21 No. 11 (2020) Vol. 21 No. 10 (2020) Vol. 21 No. 9 (2020) Vol. 21 No. 8 (2020) Vol. 21 No. 7 (2020) Vol. 21 No. 6 (2020) Vol. 21 No. 5 (2020) Vol. 21 No. 4 (2020) Vol. 21 No. 3 (2020) Vol. 21 No. 2 (2020) Vol. 21 No. 1 (2020) Vol. 20 No. 12 (2019) Vol. 20 No. 11 (2019) Vol. 20 No. 10 (2019) Vol. 20 No. 9 (2019) Vol. 20 No. 8 (2019) Vol. 20 No. 7 (2019) Vol. 20 No. 6 (2019) Vol. 20 No. 5 (2019) Vol. 20 No. 4 (2019) Vol. 20 No. 3 (2019) Vol. 20 No. 2 (2019) Vol. 20 No. 1 (2019) Vol. 19 No. 6 (2018) Vol. 19 No. 5 (2018) Vol. 19 No. 4 (2018) Vol. 19 No. 3 (2018) Vol. 19 No. 2 (2018) Vol. 19 No. 1 (2018) Vol. 18 No. 4 (2017) Vol. 18 No. 3 (2017) Vol. 18 No. 2 (2017) Vol. 18 No. 1 (2017) Vol. 17 No. 2 (2016) Vol. 17 No. 1 (2016) Vol. 16 No. 2 (2015) Vol. 16 No. 1 (2015) Vol. 15 No. 2 (2014) Vol. 15 No. 1 (2014) Vol. 14 No. 2 (2013) Vol. 14 No. 1 (2013) Vol. 13 No. 4 (2012) Vol. 13 No. 3 (2012) Vol. 13 No. 2 (2012) Vol. 13 No. 1 (2012) Vol. 12 No. 4 (2011) Vol. 12 No. 3 (2011) Vol. 12 No. 2 (2011) Vol. 12 No. 1 (2011) Vol. 11 No. 4 (2010) Vol. 11 No. 3 (2010) Vol. 11 No. 2 (2010) Vol. 11 No. 1 (2010) Vol. 10 No. 4 (2009) Vol. 10 No. 3 (2009) Vol. 10 No. 2 (2009) Vol. 10 No. 1 (2009) Vol. 9 No. 4 (2008) Vol. 9 No. 3 (2008) Vol. 9 No. 2 (2008) Vol. 9 No. 1 (2008) Vol. 8 No. 4 (2007) Vol. 8 No. 3 (2007) Vol. 8 No. 2 (2007) Vol. 8 No. 1 (2007) Vol. 7 No. 4 (2006) Vol. 7 No. 3 (2006) Vol. 7 No. 2 (2006) Vol. 7 No. 1 (2006) Vol. 6 No. 4 (2005) Vol. 6 No. 3 (2005) Vol. 6 No. 2 (2005) Vol. 6 No. 1 (2005) Vol. 5 No. 2 (2004) Vol. 5 No. 1 (2004) Vol. 4 No. 2 (2003) Vol. 4 No. 1 (2003) Vol. 3 No. 2 (2002) Vol. 3 No. 1 (2002) Vol. 2 No. 2 (2001) Vol. 2 No. 1 (2001) Vol. 1 No. 2 (2000) Vol. 1 No. 1 (2000) More Issue