cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota semarang,
Jawa tengah
INDONESIA
Journal of Biomedicine and Translational Research
Published by Universitas Diponegoro
ISSN : -     EISSN : 25032178     DOI : -
Core Subject : Health, Science,
Journal of Biomedicine and Translational Research (JBTR) is an open access, international peer-reviewed journal that considers articles on: clinical medicine, molecular medicine, tropical medicine, infectious diseases, cardiovascular medicine, molecular biology, genetics, immunology, microbiology, biochemistry, and pharmacotherapy with particular interest on the link between clinical and basic research called translational research.
Arjuna Subject : -
Articles 193 Documents
The Effects of Zinc Supplementation on Immune Response of Obese Children With Family History of Atopy W Wistiani; Dewi Ratih; M Mulyono; Saekhol Bakri
Journal of Biomedicine and Translational Research Vol 4, No 2 (2018): December 2018
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (12.889 KB) | DOI: 10.14710/jbtr.v4i2.3520

Abstract

Introduction: Obesity is associated with low-grade chronic inflammation and disbalance between cytokine production of T helper1 and T helper2 cells.  Zinc plays role in balancing immune response, has anti-oxidant and anti-inflammation activities; its deficiency also common in obesity.  The role of zinc supplementation in children with obesity with risk of atopy needs to be elucidated.Materials and Method: We performed randomized controlled trial double-blind to investigate the effect of daily 15 mg zinc supplementation for 6 weeks in children aged 13 to 14 years old with obese who has family history of atopy.  Subjects were divided into group of zinc supplementation and placebo, recruited from junior high schools from Semarang municipality, performed during periods from January to December 2013.  Plasma zinc concentration, leptin, immunoglobulin-E (Ig-E), interferon-γ (IFN-γ), interleukin-4 (IL-4) were measured, also body weight, height and ISAAC questionnaire to recruit subjects with family history of atopy.Result: There were 36 subjects.  The concentration of zinc serum, Ig-E, IFN-γ, and IL-4 of two groups before supplementation were not significantly different (p>0.05).  Zinc supplementation increase the mean level of zinc concentration on treatment group compare to placebo group (27.74+11.80 vs 3.47+2.55, p=0.000).  The concentration of Ig-E, IFN-γ and IL-4 serum were decreased at treatment group (15.5+20.46 vs 20.02+38.02, p=0.613), (1.82+3.59 vs 0.911+3.51, p=0.174), and (4.76+6.49 vs 2.44+4.41, p=0.085) respectively.  Conclusion: Zinc supplementation increased the level of zinc serum concentration of obese children and decreased the risk of atopy.
Phlebotrophic Effect of Graptophyllum Pictum (L.) Griff on Experimental Wistar Hemorrhoids Mario Sadar Bernitho Hutagalung; Bernadus Parish Budiono; Sigit Adi Prasetyo; Ignatius Riwanto; Eriawan Agung Nugroho; Yan Wisnu Prajoko; Neni Susilaningsih
Journal of Biomedicine and Translational Research Vol 5, No 1 (2019): July 2019
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14710/jbtr.v5i1.3704

Abstract

Background : The 1st and 2nd degree hemorrhoids is managed non-operatively with the anti-inflammatory and plebothropic drugs. Graptophyllum pictum extract (GPE) has already been used widely in Indonesia to treat hemorrhoid with good result, however, the mechanism is not supported by the molecular research.Objective : This study is intended to study the phlebothropic effects of GPE by measuring the degree of edema and extravassal leucocytes of experimental wistar hemorrhoid.Methods : Experimental study with Randomized Controlled Trial Post-test only design in male wistar rats, weight around 200 gr, induced for the development of a disease-like condition of hemorrhoids by 6% croton oil on the anus for 3 days. Random allocation was performed to divide the 14 wistar rats in 2 groups. Group I as control got normal saline solution, while group II was treated with GPE 100mg/kgbw, started on day 4th for 5 consecutive days. On 9th day blood was extracted from retroorbital fossa and anus was resected up to 2 cm from anal verge and weighted. The degree of anal edema was measured by rectoanal coefficient, that is rasio between anal weight (miligrams) and body weight (grams).Results : Until the end of study, all wistar rat were still alive. The mean (±SD) of body weight   of control group was 173.84 ­(±13.37) and the treatment group was 171.70  (±13.10), and there was no significant differences (p = 0.833). The mean (±SD) of rectoanal coefficient in the treatment group was 2.46 (±0.41) and it was significantly lower than control group  (3.13 ± 0.85) (p = 0.029). The mean (±SD) of extravassal leukocytes in the treatment group was 900.14(±48.09) and it was significantly lower than the control (1003.28 ± 99.30) (p = 0.042).Conclusions : Graptophyllum pictum extract at doses of 100 mg/Kgbw have phlebotonic effect  in decreased edema and extravassal leukocytes.
A long-term follow-up of Sex Chromosomal Mosaicism Disorders of Sex Development Nurin Aisyiyah Listyasari; Iit Fitrianingrum; Sultana MH Faradz
Journal of Biomedicine and Translational Research Vol 5, No 1 (2019): July 2019
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (318.3 KB) | DOI: 10.14710/jbtr.v5i1.4703

Abstract

Background:Chromosomal mosaicism is characterized by the presence of two or more distinct cell lines in an individual. Mosaicism in sex chromosome is a major component of Disorders of Sex Development (DSD) results in a large clinical spectrum of genital ambiguity.                        Case Presentation:We report long term follow-up of a 15-year-old male who was evaluated for ambiguous genitalia with a karyotype of 46,XY (85%) / 46,XX (15%). He presented with abnormal urethral opening (hypospadias) and left sided undescended testis since birth. Work-up was done for cytogenetic analysis, hormonal assays, imaging, exploratory laparotomy, and hypospadias repair. For more than 15 years he was reared as a boy, with no further complaints, until he reached puberty. He then developed gynecomastia and monthly painful hematuria. MRI evaluation revealed a left adnexal cystic mass and anteflexed uterus with loculated fluid collection posterior to urinary bladder suggesting hematometra. We discuss the genetics, diagnostics, as well as genetic counseling of this patient.Conclusion: This case is reported in view of the interesting clinical presentation of this rare mosaicism. A strong emphasis on a multidisciplinary approach and close follow-up is important to ensure both physical and psychological well-being of DSD patients.
Prevalence of Malaria Parasites among Pregnant Women and Children under Five years in Ekiti State, Southwest Nigeria. Iyabo Adepeju SIMON-OKE; M.F Ogunseem; O.J Afolabi; Oluwaseun Awosolu
Journal of Biomedicine and Translational Research Vol 5, No 1 (2019): July 2019
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (17.143 KB) | DOI: 10.14710/jbtr.v5i1.3711

Abstract

Background: Malaria is a deadly disease causing serious public health issues among pregnant women and children worldwide especially in tropical and subtropical Africa. This study was carried out to determine the prevalence of malaria parasites among pregnant women and children under five years in Ekiti State, Nigeria.Methodology: A total of 380 blood samples were collected from the pregnant women and children under five years respectively. Malaria parasites were examined microscopically on thick and thin blood smear stained with Giemsa stain while personal data were collected through questionnaire and confirmed from file records. Red cell phenotyping was carried out manually with standard tube technique for blood group. Haemoglobin electrophoresis was carried out using the cellulose acetate alkaline haemoglobin electrophoresis technique, which allowed for the separation of haemoglobin A, F, S, and C into distinct bands.Results: The results showed that of 380 pregnant women sampled, 153 (40.2%) were positive for malaria parasites and 63 (63%) were positive of the 100 children sampled. The highest prevalence of malaria parasites 18 (51.4%) and 25 (71.4%) were observed in ages 36-39 and <1 years for pregnant women and children respectively. Multigravidae was 1.19 times (95% Cl: 0.77, 1.84) more vulnerable to malaria compare to primigravidae. Women in the first trimester were more infected with malaria parasites 40 (75.4%) than those in second trimester 46 (23.3%) and third trimester 67 (51.9%). Among children under five years of age, females 38 (66.7%) had the highest prevalence compared to males 25 (58.1%). However, there was no significant difference. Statistical analysis showed a significant difference in genotype types (P<0.05).Conclusion: This study revealed that malaria infection is still endemic in the study area, hence, there is urgent need to deploy management strategy to the study area.
Fragile X syndrome, the search for a targeted treatment Shimriet Zeidler; Rob Willemsen
Journal of Biomedicine and Translational Research Vol 5, No 1 (2019): July 2019
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (337.954 KB) | DOI: 10.14710/jbtr.v5i1.3925

Abstract

Fragile X syndrome (FXS), the most common monogenetic cause of intellectual disability and autism spectrum disorders, is characterized by behavioral and physical problems. There is currently no adequate treatment available. While animal model studies seemed extremely promising, no success has been achieved in the larger clinical trials with human FXS patients. This short review describes the steps that have been taken in the development of a targeted treatment for FXS. Possible reasons for the lack of translation between animal models and human FXS patients are being explored and solutions are being proposed. The FXS story illustrates pitfalls and possibilities in translational research, that might especially be applicable for other neurodevelopmental disorders as well. 
Validation of Self-Reported Smoker and Second Hand Smoke Exposure by Urinary Cotinine within The Malaysian Cohort Project Noraidatulakma Abdullah; Shariffah Huzaimah Al-Junid; Mee Lee Looi; Siok Fong Chin; Ezanee Azlina Mohd Haniff; Syed Zulkifli Syed Zakaria; Rahman Jamal
Journal of Biomedicine and Translational Research Vol 5, No 1 (2019): July 2019
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (186.368 KB) | DOI: 10.14710/jbtr.v5i1.3971

Abstract

Background: Validation of self-reported questionnaire is very crucial in ensuring the quality and reliability of data collection. Objective: The aim of this study were i) to validate the questionnaire on tobacco smoke intake and second hand smoke exposure among The Malaysian Cohort (TMC) subjects through the determination of urinary cotinine levels, ii) to determine the optimal cut-off point of urine cotinine that discriminates smokers from non-smokers and iii) to estimate misclassification rate between self-reported smoking and urinary cotinine level.Methods: Urine samples from a total of 775 The Malaysian Cohort subjects (104 smokers, 102 former smokers and 569 non-smokers) were obtained and urinary cotinine levels were determined by high-performance liquid chromatography (HPLC). Differences between groups were compared using Kruskal Wallis and Mann-Whitney tests. The Receiver Operating Characteristic (ROC) curved was performed to define the optimal urinary cotinine cut-off point.Results: Urinary cotinine concentration significantly (p<0.001) correlated with smoking status (r=0.46), the average number of cigarettes smoked per day (r=0.53), duration of smoking (r=0.33) and number of cigarettes packed per year (r=0.47). Smokers and second hand smokers have significantly higher median cotinine levels (978.40 and 21.31 respectively) compared to non-smokers (15.52) and non-exposed (13.60) subjects. Cotinine level at cut-off value of 1.51 ng/mg creatinine is able to distinguish smokers and non-smokers with a sensitivity of 84.62% and specificity of 81.97%.Conclusion: The Malaysian Cohort self-reported smoking questionnaire is a reliable tool in assessing the use of tobacco and second hand smoke exposure among the subjects.
Seroprevalence of Hepatitis B and C in Healthy Malaysian Adults: A Preliminary Report Hui-min Neoh; Saberi bin Saimun; Rahman Jamal
Journal of Biomedicine and Translational Research Vol 5, No 1 (2019): July 2019
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (313.026 KB) | DOI: 10.14710/jbtr.v5i1.4281

Abstract

none (letter to to editor format)
Food Intake and Visceral Fat Deposition are Risk Factors of Incidence and Severity of Non-Alcoholic Fatty Liver Disease Risky Ika Riani; Hery Djagat Purnomo; Siti Fatimah Muis
Journal of Biomedicine and Translational Research Vol 3, No 2 (2017): December 2017
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (772.948 KB) | DOI: 10.14710/jbtr.v3i2.1810

Abstract

Background: Non alcoholic fatty liver disease (NAFLD) is abnormalities of metabolism resulting in fat deposition in the hepatocyte occurred in people who do not consume alcohol. Carbohydrate and fat intake, also visceral fat deposition has been studied as a risk factor of NAFLD, however the results remain elusive.Objective: To identity the nutritional and clinical risk factors of the incidence and severity of NAFLD.Methods: This study was done from June to December 2014 in the Dr. Kariadi Hospital Semarang. A case-control group was established comprising 33 patients with NAFLD based on the ultrasonography (USG) criteria (case group) and 34 healthy subject (control group). Carbohydrate and fat intake was assessed by using the food frequency questionnaire (FFQ), visceral fat deposition was measured by body impedance analysis (BIA), and clinical markers were obtained from laboratory data.Results: Carbohydrate intake, fat intake, and visceral fat deposition were risk factors of the incidence and severity of NAFLD (OR=7.8, CI95% 2.43-25.45; OR=5.9, CI95% 2.0-17.57; OR=50.7, CI95% 6.16-418.09) and (OR=0.9, CI95% 1.06-90.58; OR=14.6, CI95% 1.37-156.88; OR=6.6, CI95% 1.17-37.78). Multivariate regression showed that the most important risk factor of NAFLD for the incidence and severity were hypertriglyceridemia (OR=8.7, CI95% 2.20-34.44) and fat intake (OR=48.4, CI95% 2.78-844.1), respectively.Conclusion: High carbohydrate intake, fat intake, and high visceral fat deposition are risk factors of the incidence and severity of NAFLD. Hypertriglyceridemia and fat intake are the most important risk factor of NAFLD incidence and severity, respectively.
Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach Minuljo, Tania Tedjo; Gasem, Muhammad Hussein; Hadi, Purnomo
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (36.211 KB) | DOI: 10.14710/jbtr.v3i1.866

Abstract

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.
The Effect of Eurycoma longifolia Jack on sICAM-1 and eNOS in Rats with High Fat Diet Anas Omar Ashkurfu; Kis Djamiatun
Journal of Biomedicine and Translational Research Vol 4, No 1 (2018): July 2018
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (782.904 KB) | DOI: 10.14710/jbtr.v4i1.2670

Abstract

Background: High fat diets are known to cause a positive fat balance and consequently to the accumulation of adipose mass, this diet does not seem to stimulate fat oxidation in the same way in obese and lean subjects. HFD was an inducing factor for ICAM-1 expression in the aorta of Wistar rats. HFD effect on ICAM-1 seems to be time dependent. ICAM-1 is one of the first events in the formation of atherosclerotic lesions. HFD up-regulated Cav-1, regulated expression other biomarker in HFD is eNOS. Recent studies showed that E. longifolia Jack protected HFD animal model from atherosclerosis based on the reduce atherosclerotic plaque size and formation HFD-rats treated with E. longifolia Jack.Objective: To prove that Eurycoma longifolia has anti inflammatory effect on endothelial cell blood vessels of Sprague Dawley rat with high fat diet.Method: Study design was experimental study, by used Randomized Post Test only Control Group Design with Kruskal-Wallis test was used to analyze the differences among groups and followed by a Mann Whitney test. Treatment is ethanolic or water extract of Eurycoma longifolia Jack, and out come are sICAM-1 and eNOS levels. Thirty Sprague Dawley (SD) Rat, were divided into 6 groups. C(-) was SD group, C(+) was group with HFD, X1 (SD treated with EL dosage 10 mg/kg), X2 (SD treated with EL dosage 15 mg/kg), X3 (HFD treated with EL dosage 10 mg/kg), X4 (HFD treated with EL dosage 15 mg/kg).

Page 2 of 20 | Total Record : 193