Garuda - Garba Rujukan Digital

Article Per Year (5 Year)

All

Natural B

NATURAL B
Website

Published by Universitas Brawijaya

ISSN : - EISSN : - DOI : -

Core Subject : Social,

Environmental Science

Anda dapat mengakses artikel-artikel hasil penelitian khususnya bidang lingkungan dan kesehatan. Untuk informasi lebih lanjut, silakan menghubungi redaksi jurnal.

Arjuna Subject : -

Articles 200 Documents

7 8 9 10 11

Amplification Pattern of Partial Gene BMP-15 and GDF-9 in Bali Cattle Sri Rahayu; M. Sasmito Djati; Agatha Maria Dian Kusumawati; Oktavia Fitri Santika
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The aim of this research was to determine the polymorphisms of BMP-15 and GDF-9 gene of Bali cattle. DNA was isolated from blood samples of six female cattles with salting out method. Quantitative and qualitative analysis of DNA was measured using spectrophotometer and agarose gel electrophoresis. To get DNA fragment BMP-15 gene was amplified using Forward (5’- AGTTTGTACTGAGCCGGTCT -3'), Reverse (5’- CTGACACACGAA GCGGAGT -3’), while to get DNA fragmen GDF-9 gene was amplified using Forward primer (5’-CAAGGAGGGGACCCCTAAAT-3’), reverse primer (5’- ACCAGAGGCTCAAGAGGAGC- -3’) for GDF-9. The results of amplification showed 4 haplotypes for BMP-15 and GDF-9 gene. It was concluded that there is polymorphism of BMP-15 and GDF-9 gene of Bali cattle.

Geomagnetic Survey In Cangar Area, Batu City, East Java To Assess the Potential of Geothermal Akhmad Afandi; Sukir Maryanto; Adi Susilo
Natural B, Journal of Health and Environmental Sciences Vol 1, No 3 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The prospect ofgeothermal field of Cangar’s in Batu, East Java has been observed based on the geomagneticmethod using aProtonPrecisionMagnetometer (PPM-856).The purpose is to know the magnetic anomalies around the geothermal area. The resultsshown that the residual anomaly distributed in the range of -1.000 nT to 680 nT and the low anomaly(negative) at about -1.000nTlocatedonthe northand westof themanifestations ofhotwater. Geothermalpotential based on the subsurfacemodeling of the structures on the line A-B at position 49 M 0669,071.13174 mT UTM 9,144,184.60107 mU has a value of susceptibilitycontrast of -3.166with a volume of ± 1,550,345m3. Furthermore, on the line C-D at position 49 M 0669,168.601085 mT UTM 9,143,915.10292 mU shown a value of susceptibilitycontrast at -0.018with thevolume of ± 16,610m3.

Applications of Cellulolytic Microorganisms and Watering Frequency in Early Seedling of Palm Oil in Peatlands Gusmawartati Gusmawartati
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

This research aimed to determine optimum water necessity by using cellulolytic microorganism to enhance growth of oil palm on pre-nursery in peat soil. The research was conducted at an area with peat soil as growth media was taken from desa Rimbo Panjang Kabupaten Kampar Province of Riau by Factorial Completely Randomized Design with three replication. The first factor consists of: 0, 10, 20 and 30 (mL/polybag) of cellulolytic microorganism. The other one consists of: 2, 3 and 4 (times/day) watering. The result showed that cellulolytic microorganism with frequency of watering could improve peat soil fertility and increased growth of oil palm in pre-nursery. Use of 30 ml cellulolytic microorganism with 2 times watering/day decreased C/N ratio till 26% and increased 1–1.5 of soil pH and created the best growth of oil palm seed, is equal to standart wich is recominded by the central oil palm research of Indonesia.

Design of Cell Construction for Immunosensor Based Quartz Crystal Microbalance (QCM) Farida Wahyuni; Setyawan Purnomo Sakti; Unggul P. Juswono; Fenny Irawati; Nur Chabibah
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The biosensor is a sensor device that combines biological compounds with a transducer. One type of biosensor that uses mass change detection techniques are QCM (Quartz Crystal Microbalance). QCM is a sensor that works with the principle of quartz crystal frequency shift due to mass deposition on the surface of the crystal. QCM can be used to detect the reaction between the molecules, so that the QCM can serve as biosensors that can be used for the diagnosis of a disease. In the development of QCM immunosensor for there are many problems, one of which is the construction of the cell. Construction cells can be used as a reaction between biomolecules. Construction of cells made of white Teflon. To keep QCM sensors are not experiencing physical stress that can lead to rupture due to pressure from the Teflon o-ring is used as an insulating silicon. The results of this study indicate that the construction of the cells created can be used as a medium for immobilization of Bovine Serum Albumin observations (BSA) on the surface of the sensor.

Optimal Control Design of Eco-Friendly Power Generators Using Wind Power Ahmad Nadhir; Agus Naba
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

Two optimal control methods based on fuzzy inference system (FIS) for maximizing extraction of energy in wind energy conversion system (WECS) is already presented. An MPPTFIS is a first optimal control method using maximum power point tracking approach and fuzzy system. The objective of MPPTFIS is to make zero value change rate of power and rotor speed. A control system will drive an actuator to increasing or decreasing the generator speed depend on the measurement rate of power and rotor speed. An optimal of WECS can be achieved by carried through the rate of power and rotor speed that operating near optimal point. The second optimal control method is proposed by using adaptive neuro fuzzy inference system (ANFIS) to finding model of power curve that will be applied for design of linear control feedback (LCANFIS). The advantage of LCANFIS than MPPTFIS is only one parameter measusrement needed: wind speed. MPPTFIS and LCANFIS could maximize extraction of the wind energy that verified by a power coefficient Cp stay at its maximum almost all the time and an actual power line close to a maximum power extraction (MPE) line reference during simulation process using a same of wind profile.

Patchouli Oil Characteristics by Optimization Result of Distillation Time of Patchouli Leaf Dewaxing and Fermentation Sentot Joko Raharjo; Rurini Retnowati; Soebiantoro Soebiantoro
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The characteristic of patchouli oil of dewaxing, fermentation and time distillation toward patchouli leaves used GC-MS have been done. The aim of the study was to characterization of patchouli oil on distillation time of patchouli leaves of dewaxing and fermentation. The characteristics of patchouli oil on the distillation time for 12 hours, then the distillate collected every 2 hours showed that of the best result was the 3rd fraction collected distillate time of 12 hours with a yield of 0.56 %, light yellow color, specific gravity 0.9685 g/ mL and a refractive index of 1.5095 and patchouli alcohol of 69.56 %. Characteristics of patchouli oil on distillation time (2, 4, 6, 8, 10, 12) hours showed that of the best result was time distillation for 12 hours with a yield of 6.61 %, light yellow color, specific gravity of 0.9672 g/ mL, refractive index of 1.5082 and patchouli alcohol of 45.69 %. The other components of patchouli oil detected were alpha-gurjunene, cis-thujosene, beta-patchoulene, alpha-patchoulene, beta-caryophyllene, alpha-guaiene, seychellen, aromadendrene, beta-gurjunene, alpha-humulene, alpha-bulnesene, gemacrene-D, dehidroaromadendrene, gemacrene-A, gamma-patchoulene, valencene, viridiflorene, selina-3,7-(11)-dien, nor-patchoulenol, pogostol, illudol, globulol, beta-caryophyllen oksida, viridiflorol and ledol. Patchouli oil quality to meet requirements SNI 06-2385-2006 and ISO 3757:2002.

Efficacy of Mycoparasite Fecal Fungi Lecanicillium lecanii against Rust Disease (Phakopsora pachyrhizi) at Soybean (Glycine max L. Merril) Bintan R; Amin S. Leksono; Yusmani Prayogo
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The obstacle of efforts to increase the production of soybean is rust disease caused by obligate the parasite fungus Phakopsora pachyrhizi. One type of biological agent used to control rust disease is a mycoparasite fungus Lecanicillium lecanii. The aim of this study was to determine the effective density of conidia L. lecanii fungus for rust disease control and its impact on soybean yields. The study using complete randomized block design, three replication. The treatment was the density of conidia L. lecanii i.e 104/mL, 105/mL, 106/mL, 107/mL, 108/mL and control. Isolates of the fungus L. lecanii was propagated on potato dextrose medium agar (PDA) in petri dishes. At the age of 21 days after inoculation conidia was taken one gram, then it was diluted with 10 ml sterile water and counted with a haemocytometer to obtain conidia density appropriate with the treatment. Furthermore, any suspension of conidia L. lecanii was applied to soybean at age 49-70 days after planting that was attacked by rust disease. Data were analyzed by ANOVA with SPSS 16.0 for windows. The analysis showed that treatment with a density of conidia 108/ml have better efficacy, as shown by the low intensity of the attacks by 15.9% compared to controls reached 27.15%. These results are also followed by a high number of fill-pods on the treatment 108/mL as much as 54.4 pods, dry seed weight of 9.85 grams, dry weight of 100 seeds 8.73 grams. Therefore that L. lecanii fungus with density of conidia 108/mL can suppress the development of rust disease, can be used as a biological agent for substitute of chemical fungicides.

Magnetic Levitation for Separation of Plastic Polyethylene Terephthalate (PET) and Polyvinyl Chloride (PVC) Gancang Saroja; Suyatman Suyatman; Nugraha Nugraha
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

In the recycling of plastic waste, the process of plastic separation is often faced with the problem of the difficulty of separating PET from PVC plastics. The main objective of this research was to separate a mixed PET and PVC plastics using magnetic levitation. In the experiment, the samples were PET and PVC plastics from used bottles packaging found in the market. The magnetic field was derived from arrangement of the permanent magnets made from Neodymium with a cylinder shape with an orientation of magnetic moment parallel to its axis. Magnets were arranged so as to produce a magnetic field gradient in the vertical direction. The magnetic inductions at the respective surface of each magnet were 0.244, 0.349, 0.412, 0.443, 0.463, and 0.476 T. The paramagnetic fluid used was solution of MnCl2 with a concentration of 1, 1.5, 2, 2.5, and 3 M. The results showed that at Bo of 0,476 T, the fluid with the concentration of 3 M produced the highest levitation and the best separation of PET from PVC plastics.

Motion Range Event Detection Method on Application of Genesis Detection System on Volcanic Visual Monitoring Rio Arie Purnama; Sukir Maryanto; Didik R. Santoso
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The process of volcano research through visual monitoring usually takes a long time. There is many time possibility of an occurance of a specific volcano phenomena such as lava and plum. The problem with this monitoring activity can be helped through visual monitoring system that enables constant recording and automatically detects events that can be observed through the visual volcano object. This monitoring system works through an event detection application with static object definitive, fixed focus definitive and sensing area definitive combination method that forms a simple yet effective method called Motion Range Event Detection. This method is a form of volcano object monitoring using camera sensors by defining the form of volcano object as a static object and defining the object phenomena changes based on a predetermined area.

Filler Composition Effects on Tensile Strength And Composite Material Toughness of Rice-Resin Husk Powder Istiroyah Istiroyah; L. Nuriyah; Retnowati Retnowati
Natural B, Journal of Health and Environmental Sciences Vol 1, No 4 (2012)
Publisher : Natural B, Journal of Health and Environmental Sciences

The rice husk flour- resincomposite has been made. This research aims to make the rice husk flour - resin composite and analyze the effect of filler composition to their tensile strength and toughness. The filler composition used is 0%, 10%, 20%, 30, 40%, 50% dan 60%. The Results of tensile test show that the best tensile strength is 113.02 ±11.60 MPa for polystiren sample. The best toughness with impact test is 47.92±0,36 KJ/m2 for 30% filler with polyester resin.

Page 9 of 20 | Total Record : 200

7 8 9 10 11

Filter by Year

2011 2019

Filter By Issues

All Issue Vol 5, No 2 (2019) Vol 5, No 1 (2019) Vol 4, No 4 (2018) Vol 4, No 3 (2018) Vol 4, No 2 (2017) Vol 4, No 1 (2017) Vol 4, No 1 (2017) Vol 3, No 4 (2016) Vol 3, No 3 (2016) Vol 3, No 2 (2015) Vol 3, No 1 (2015) Vol 2, No 4 (2014) Vol 2, No 3 (2014) Vol 2, No 2 (2013) Vol 2, No 1 (2013) Vol 2, No 1 (2013) Vol 1, No 4 (2012) Vol 1, No 3 (2012) Vol 1, No 2 (2011) Vol 1, No 1 (2011) Vol 1, No 1 (2011) More Issue

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kota malang,

Jawa timur

INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name -

Contact Email -

Phone -

Journal Mail Official -

Editorial Address -

Location Kota malang, Jawa timur INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kota malang,

Jawa timur

INDONESIA