Garuda - Garba Rujukan Digital

VARIASI JUMLAH KROMOSOM TALAS BENTUL (COLOCASIA ESCULENTA (L.) SCHOTT) IN VITRO HASIL PERLAKUAN ORIZALIN Ermayanti, Tri Muji; Rantau, Deritha Ellfy; Wulansari, Aida; Martin, Andri Fadillah; Hafiizh, Erwin Al
JURNAL BIOLOGI INDONESIA Vol 15, No 1 (2019): JURNAL BIOLOGI INDONESIA
Publisher : Perhimpunan Biologi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/jbi.v15i1.3765

ABSTRACTChromosome number analysis is required after polyploid induction with oryzalin. Flowcytometry analysis is a simple and quick method to determine the ploidy level, however, chromosome number analysis is needed in order to confirm variation in the chromosome numbers which has occurred. The aim of the research was to investigate chromosome number variation of polyploid taro (Colocasia esculenta) after in vitro treatment with oryzalin. Nine treated-oryzalin clones and four taro cultivars, as control treatment, were used in this experiment. Ploidy level confirmation was done by flowcytometry analysis, meanwhile chromosome number calculation was performed by squashing method. Roots were isolated from in vitro plantlets for squashing, leaves were isolated from the same plantlets were used for flowcytometry analysis. At least three plants consisted of 6-52 cells having good chromosome distributions were calculated for their chromosome numbers. The results showed that ploidy level of taro corresponded to the number of chromosomes. Flowcytometry analysis of diploid, triploid, tetraploid as well as hexaploid clones, all has chromosome numbers similar to those as their ploidy levels. Range of the chromosome numbers varied, with most of cells had around their normal chromosome numbers. From 5 to 15% of cells had aneuploid numbers lower or above their normal chromosome numbers. Keywords : Colocasia esculenta, flowcytometer, polyploid, chromosome number, oryzalin, in vitro

VARIASI JUMLAH KROMOSOM TALAS BENTUL (COLOCASIA ESCULENTA (L.) SCHOTT) IN VITRO HASIL PERLAKUAN ORIZALIN Ermayanti, Tri Muji; Rantau, Deritha Ellfy; Wulansari, Aida; Martin, Andri Fadillah; Hafiizh, Erwin Al
JURNAL BIOLOGI INDONESIA Vol 15, No 1 (2019): JURNAL BIOLOGI INDONESIA
Publisher : Perhimpunan Biologi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/jbi.v15i1.3765

ABSTRACTChromosome number analysis is required after polyploid induction with oryzalin. Flowcytometry analysis is a simple and quick method to determine the ploidy level, however, chromosome number analysis is needed in order to confirm variation in the chromosome numbers which has occurred. The aim of the research was to investigate chromosome number variation of polyploid taro (Colocasia esculenta) after in vitro treatment with oryzalin. Nine treated-oryzalin clones and four taro cultivars, as control treatment, were used in this experiment. Ploidy level confirmation was done by flowcytometry analysis, meanwhile chromosome number calculation was performed by squashing method. Roots were isolated from in vitro plantlets for squashing, leaves were isolated from the same plantlets were used for flowcytometry analysis. At least three plants consisted of 6-52 cells having good chromosome distributions were calculated for their chromosome numbers. The results showed that ploidy level of taro corresponded to the number of chromosomes. Flowcytometry analysis of diploid, triploid, tetraploid as well as hexaploid clones, all has chromosome numbers similar to those as their ploidy levels. Range of the chromosome numbers varied, with most of cells had around their normal chromosome numbers. From 5 to 15% of cells had aneuploid numbers lower or above their normal chromosome numbers. Keywords : Colocasia esculenta, flowcytometer, polyploid, chromosome number, oryzalin, in vitro

ACCLIMATION AND AGRONOMIC PERFORMANCE OF POLYPLOIDS CLONES OF ARTEMISIA ANNUA L. Rahman, Wiguna; Hafiizh, Erwin Al; Ermayanti, Tri Muji; Rantau, Deritha Ellfy; Lelono, Arthur A.
JURNAL BIOLOGI INDONESIA Vol 13, No 1 (2017): JURNAL BIOLOGI INDONESIA
Publisher : Perhimpunan Biologi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/jbi.v13i1.3092

ABSTRACTSomatic cell manipulation of Artemisia annua L. was conducted by induction of polyploid plants with Colchicine and Oryzalin in order to increase level of artemisinin. Polyploid plantlets were multiplied on MS medium without plant growth regulators. After acclimation processes, plants were grown in the field for agronomic performance observation. Survival rate of plantlets was recorded. Agronomic performance of plants was observed by recording height of plants, number of branches, leaf biomass, stomatal characteristics, and artemisinin content. The results showed that survival rate of the plantlets from Colchicine and Oryzalin treatments were ranging from 13.40 to 33.33% and 11.11 to 41.67%, respectively. Growth rates of plant height and plant branching were not significantly different between diploid and tetraploid plant both from Colchicine and Oryzalin treatments, except to triploid plants from Colchicine treatment. Averages of plant height from Colchicine and Oryzalin treatments were ranging from 10.0 to 220.0 cm and from 35.0 to 186.0 cm, respectively. The averages number of branches per plant of polyploid plants from Colchicine and Oryzalin treatments were ranging from 3 to 66 and from 11 to 63, respectively. Averages of dry leaves biomass between diploid and tetraploid plant from Colchicine and Oryzalin treatments were also not significantly different. They were ranging from 12 to 64 g/plant and from 11 to 62 g/plant, respectively. However, tetraploid clones have bigger size of stomata and produced more artemisinin than the diploids.Keywords: Artemisia annua L, Colchicine, Oryzalin, Polyploids, Acclimation, Agronomic performance

Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early. This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R: 5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.

Title

Found 4 Documents
Search

Abstract

Abstract

Abstract

Abstract

Title Search

Found 4 Documents Search

Abstract

Abstract

Abstract

Abstract

Title

Found 4 Documents
Search