Article Per Year (5 Year)
p-Index From 2020 - 2025
0.659
P-Index
This Author published in this journals
All Journal BIOTROPIA - The Southeast Asian Journal of Tropical Biology Jurnal Penelitian Tanaman Industri Buletin Penelitian Tanaman Rempah dan Obat AGRIVITA, Journal of Agricultural Science Jurnal Biologi Universitas Andalas BERITA BIOLOGI JURNAL BIOLOGI INDONESIA Buletin Penelitian Tanaman Rempah dan Obat Agroscript: Journal of Applied Agricultural Sciences
Sitti Fatimah Syahid
Balai Penelitian Tanaman Obat dan Aromatik
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Decision Sciences, Operations Research & Management Immunology & microbiology Industrial & Manufacturing Engineering Veterinary

Published : 12 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 12 Documents
Search

 1   2 
PENGARUH AUKSIN IAA, IBA, DAN NAA TERHADAP INDUKSI PERAKARAN TANAMAN STEVIA (Stevia rebaudiana) SECARA IN VITRO Arlianti, Tias; Syahid, Sitti Fatimah; Kristina, Natalini Nova; Rostiana, Otih
Buletin Penelitian Tanaman Rempah dan Obat Vol 24, No 2 (2013): Balai Penelitian Tanaman Rempah dan Obat
Publisher : Balittro

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAKInduksi perakaran merupakan tahapan yang sangat penting dalam pembentukan benih secara in vitro. Perbanyakan stevia (Stevia rebaudina) secara konvensional melalui setek atau biji terkendala pada tingkat keberhasilan, keseragaman, dan produksi rendah. Perbanyakan inkonvensional melalui kultur jaringan telah berhasil dilakukan sampai dengan tahap multiplikasi tunas. Keberhasilan tersebut perlu didukung dengan inisiasi akar melalui induksi dengan penambahan zat pengatur tumbuh. Penelitian ini bertujuan untuk mengukur respon stevia terhadap zat pengatur tumbuh induksi perakaran in vitro. Penelitian dilakukan sejak Maret sampai Agustus 2012 di laboratorium kultur jaringan Balittro dan Kebun Percobaan Manoko. Bahan tanaman yang digunakan adalah tunas aseptik stevia dari kultur yang berumur tiga bulan pada media penyimpanan MS + B 0,1 mgl-1. Tunas stevia dikulturkan pada media MS dengan penambahan IAA (0,1; 0,2; dan 0,3) mg l-1, IBA (0,1; 0,2; dan 0,3) mg l-1, dan NAA (0,1; 0,2; dan 0,3) mg l-1. Rancangan penelitian yang digunakan adalah Acak lengkap dengan sepuluh ulangan. Parameter yang diamati adalah jumlah dan tinggi tunas, jumlah dan panjang akar, dan tingkat keberhasilan aklimatisasi. Hasil penelitian menunjukkan bahwa penambahan NAA 0,2 dan 0,3 mg l-1 memacu pertumbuhan jumlah akar terbaik. Pada tahap aklimatisasi, persentase keberhasilan masih rendah dan perlu didukung dengan kondisi lingkungan yang optimum.Kata kunci: Stevia rebaudina, induksi perakaran, in vitro, auksin
STABILITAS HASIL DAN MUTU ENAM GENOTIPE HARAPAN JAHE PUTIH KECIL (Zingiber officinale Rosc. var amarum) PADA BEBERAPA AGROEKOLOGI BERMAWIE, NURLIANI; SYAHID, SITTI FATIMAH; AJIJAH, NUR; PURWIYANTI, SUSI; MARTONO, BUDI
853-8212
Publisher : Pusat Penelitian dan Pengembangan Perkebunan

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAKPeningkatan produktivitas dan mutu jahe putih kecil memerlukanbahan tanaman unggul. Tujuan penelitian ini adalah untuk mengetahuistabilitas hasil dan mutu enam genotipe jahe putih kecil pada berbagaikondisi agroekologi. Enam genotipe harapan jahe putih kecil dan duagenotipe lokal sebagai pembanding diuji selama dua musim tanam diempat lokasi (Sukabumi, Sumedang, Majalengka, dan Garut) pada tahun2004 sampai 2006. Rancangan percobaan dilakukan mengikuti rancanganacak kelompok (RAK) dengan tiga ulangan. Jarak tanam 60 x 40 cmdengan populasi per plot sebanyak 100 tanaman. Parameter yang diamatiadalah hasil (bobot rimpang per rumpun) dan mutu (kadar minyak atsiri,fenol total, sari larut air, dan sari larut alkohol). Analisis stabilitas hasilmenggunakan metoda Yau dan Hamblin. Hasil pengujian menunjukkangenotipe ZIOF-0049 dan ZIOF-0050 menghasilkan rimpang dengan rataanbobot aktual cukup tinggi serta stabil pada berbagai kondisi agroeokologi.Kadar minyak atsiri genotipe ZIOF-0049 sedang (2,92%), sedangkanZIOF-0050 tinggi (3,28%). Genotipe ZIOF-0046 memiliki kadar minyakatsiri cukup tinggi (3,91%), dan stabil di seluruh unit pengujian. Selainkadar minyak atsiri genotipe ZIOF-0046 juga memiliki kadar fenol(3,04%) dan kadar sari larut air (24,40%) yang cukup tinggi. GenotipeZIOF-0008 memiliki kadar minyak atsiri yang tinggi (3,64%) dan stabilpada berbagai unit pengujian. Empat genotipe ZIOF-0049, ZIOF-0050,ZIOF-0046, dan ZIOF-0008 menunjukkan karakter stabil pada sifat hasildan mutu rimpang sehingga layak untuk direkomendasikan sebagaigenotipe unggul dan beradaptasi luas.Kata kunci: Zingiber officinale var. amarum, jahe putih kecil, interaksigenetik dan lingkungan, hasil, mutuABSTRACTThe provision of superior genotype having stable yield andquality is a prerequisite for the productivity and quality improvement ofsmall white ginger. Research to study stability of yield and quality wasundertaken on six promising genotypes with two control variety by multienvironmental tests in four locations (Sukabumi, Sumedang, Majalengka,and Garut) for two growing seasons from 2004-2006. The experimentused a randomized block design with three replicates, 60 cm x 40 cm plantspacing, 100 plants per plot. Parameters observed were fresh rhizomeyield and quality (essential oil content, total phenolic content, watersoluble extract, and alcohol soluble extract). Stability analysis wasundertaken based on Yau and Hamblin method. Genotype ZIOF-0049 andZIOF-0050 produced the high rhizome weight and considered to berelatively stable at four locations. Essential oils content of ZIOF-0049were medium (2,92%) and ZIOF-0050 were high (3,28%). Genotypes thathave high content of essential oil (3,91%) and stable in various testing unitwas ZIOF-0046. In addition to the essential oil content, genotypes ZIOF-0046 also had phenol (3,04%) and water-soluble extract (24,40%) contentwere high. Genotype ZIOF-0008 has a high volatile oil content (3,64%)and stable in various testing unit. Four genotypes ZIOF-0049, ZIOF-0050,ZIOF-0046 and ZIOF-0008 showed stable in rhizome yield and qualitycharacters. That were deserves to be recommended as superior genotypesand wide adaptation.Key words: Zingiber officinale var. amarum, small white ginger, geneticand environment interaction, yield, quality
PENGARUH AUKSIN IAA, IBA, DAN NAA TERHADAP INDUKSI PERAKARAN TANAMAN STEVIA (Stevia rebaudiana) SECARA IN VITRO Arlianti, Tias; Syahid, Sitti Fatimah; Kristina, Natalini Nova; Rostiana, Otih
Buletin Penelitian Tanaman Rempah dan Obat Vol 24, No 2 (2013): Balai Penelitian Tanaman Rempah dan Obat
Publisher : Balittro

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAKInduksi perakaran merupakan tahapan yang sangat penting dalam pembentukan benih secara in vitro. Perbanyakan stevia (Stevia rebaudina) secara konvensional melalui setek atau biji terkendala pada tingkat keberhasilan, keseragaman, dan produksi rendah. Perbanyakan inkonvensional melalui kultur jaringan telah berhasil dilakukan sampai dengan tahap multiplikasi tunas. Keberhasilan tersebut perlu didukung dengan inisiasi akar melalui induksi dengan penambahan zat pengatur tumbuh. Penelitian ini bertujuan untuk mengukur respon stevia terhadap zat pengatur tumbuh induksi perakaran in vitro. Penelitian dilakukan sejak Maret sampai Agustus 2012 di laboratorium kultur jaringan Balittro dan Kebun Percobaan Manoko. Bahan tanaman yang digunakan adalah tunas aseptik stevia dari kultur yang berumur tiga bulan pada media penyimpanan MS + B 0,1 mgl-1. Tunas stevia dikulturkan pada media MS dengan penambahan IAA (0,1; 0,2; dan 0,3) mg l-1, IBA (0,1; 0,2; dan 0,3) mg l-1, dan NAA (0,1; 0,2; dan 0,3) mg l-1. Rancangan penelitian yang digunakan adalah Acak lengkap dengan sepuluh ulangan. Parameter yang diamati adalah jumlah dan tinggi tunas, jumlah dan panjang akar, dan tingkat keberhasilan aklimatisasi. Hasil penelitian menunjukkan bahwa penambahan NAA 0,2 dan 0,3 mg l-1 memacu pertumbuhan jumlah akar terbaik. Pada tahap aklimatisasi, persentase keberhasilan masih rendah dan perlu didukung dengan kondisi lingkungan yang optimum.Kata kunci: Stevia rebaudina, induksi perakaran, in vitro, auksin
Pertumbuhan dan Produksi Rimpang Temu Lawak di Polybag yang Benihnya Hasil Kultur In Vitro Hadipoentyanti, Endang; Syahid, Sitti Fatimah
JURNAL BIOLOGI INDONESIA Vol 3, No 2 (2001): JURNAL BIOLOGI INDONESIA
Publisher : Perhimpunan Biologi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/jbi.v3i2.3481

Abstract

ABSTRACTGrowth and Yield of Temoe Lawak in Polybag which Planting Material from In Vitro Culture. The growth and yield of temoe lawak (Curcuma xanthorrhiza Roxb.) from in vitro culture was conducted in the green house, Bogor from October 2000 to September 2001. The materials were obtained from temoe lawak plant two months after acclimatizating. The plant were planted in the polybag 60 cm x 60 cm. The treatments were consisted of the mixtures of soil and cattle manure with the proportional of 1 : 1 ; the soil and rice husk (1 : 1) ; the soil, cattle manure and rice husk (1 : 1 : 1). The experiment was designed according to randomized block design with three replicates and ten polybags per replicate .The parameters observed were plant performance, growth percentage at 5 and 10 months, rhizome weight per plant, length and width of primery rhizome, roots and water rhizome weight per plant. The result of experiment showed that the growth percentage of plant were 100% on ten months for all treatments. The growth and rhizome performance were similar with the parent. The best treatment for growth was the mixture of soil and cattle manure on the proportional of 1 : 1, with tiller numbers (3,57) , leaves number (18,2), plant height (140,6 cm) in five moths, rhizomes weight per plant (472,8 g), length and width of primery rhizome each 8,1 cm and 6,3 cm in ten months.Key words : Curcuma xanthorrhiza Roxb, growth, yield, in vitro
PENGARUH MEDIA DASAR MS DAN N TERHADAP PERKEMBANGAN EMBRIO 6 SOMATIK PADA KULTUR MERISTEM JAHE (Zingiber officinale Rosc.) Rostiana, Otih; Syahid, Sitti Fatimah
BERITA BIOLOGI Vol 8, No 5 (2007)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (225.828 KB) | DOI: 10.14203/beritabiologi.v8i5.1899

Abstract

This study was performed to evaluate the development of somatic embryo from embryogenic calli of ginger meristem culture. Completely randomized design was applied, replicated 4 times. Embryogenic calli from meristem tissue of inner shoot bud of rhizome obtained on MS medium containing 100 mg/L glutamine, 2% sucrose with the addition of 1.0 mg/L 2,4-D and 3.0 mg/L BA, were subjected to proliferation medium, MS and N basal media containing 3% mannitol. Then, transferred into somatic embryo maturation medium, either MS or N basal media supplemented with 6% sucrose. The number of somatic embryos-formed significantly affected by the proliferation medium applied. The highest number of somatic embryos (about 82.0 per 1 g friable calli) was achieved on the MS medium, 4 weeks after incubation. In addition, the optimum growth of embryogenic calli containing somatic embryos was obtained on MS and N medium supplemented with 6% sucrose. There were significantly difference between the media applied (MS and N ) to somatic embryos maturation. The highest number of mature somatic embryos (57.2 embrios) was achieved on the MS medium, 18 days after incubation.
PERTUMBUHAN DAN PRODUKSI RIMPANG TEMU LAWAK DI POLYBAG YANG BENIHNYA HASIL KULTUR IN VITRO Hadipoentyanti, Endang; Syahid, Sitti Fatimah
JURNAL BIOLOGI INDONESIA Vol 3, No 2 (2001): JURNAL BIOLOGI INDONESIA
Publisher : Perhimpunan Biologi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/jbi.v3i2.3481

Abstract

ABSTRACTGrowth and Yield of Temoe Lawak in Polybag which Planting Material from In Vitro Culture. The growth and yield of temoe lawak (Curcuma xanthorrhiza Roxb.) from in vitro culture was conducted in the green house, Bogor from October 2000 to September 2001. The materials were obtained from temoe lawak plant two months after acclimatizating. The plant were planted in the polybag 60 cm x 60 cm. The treatments were consisted of the mixtures of soil and cattle manure with the proportional of 1 : 1 ; the soil and rice husk (1 : 1) ; the soil, cattle manure and rice husk (1 : 1 : 1). The experiment was designed according to randomized block design with three replicates and ten polybags per replicate .The parameters observed were plant performance, growth percentage at 5 and 10 months, rhizome weight per plant, length and width of primery rhizome, roots and water rhizome weight per plant. The result of experiment showed that the growth percentage of plant were 100% on ten months for all treatments. The growth and rhizome performance were similar with the parent. The best treatment for growth was the mixture of soil and cattle manure on the proportional of 1 : 1, with tiller numbers (3,57) , leaves number (18,2), plant height (140,6 cm) in five moths, rhizomes weight per plant (472,8 g), length and width of primery rhizome each 8,1 cm and 6,3 cm in ten months.Key words : Curcuma xanthorrhiza Roxb, growth, yield, in vitro
PENGARUH BEBERAPA TARAF KONSENTRASI BA TERHADAP MULTIPLIKASI TUNAS CINCAU HITAM (Mesona palustris) IN VITRO Miftakhurohmah, Miftakhurohmah; Syahid, Sitti Fatimah
Buletin Penelitian Tanaman Rempah dan Obat Vol 17, No 1 (2006): BULETIN PENELITIAN TANAMAN REMPAH DAN OBAT
Publisher : Pusat Penelitian dan Pengembangan Perkebunan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21082/bullittro.v17n1.2006.%p

Abstract

Mesona palustris is one of the medi-cinal plant which is potential to be developed. Recently, the agribisnis of this plant commo-dity is considered to be potential. To support  the availability of plant material, propagation by tissue culture technique being a good alternative for mass production. This expe-riment was conducted from January to April 2005 at the Tissue Culture Laboratory of Indonesian Spices and medicinal Crops Research Institute (ISMECRI) in Bogor. The objective of this research was to find out the effect of several concentrations of BA on shoot multiplication of Mesona palustris. The treatments tested were several concentrations of BA e.g. : 0.0 ( control); 0.2 ; 0.4; 0.6; and 0.8 mg/l. Experiment was arranged in a com-pletely randomized design with six replica-tions. The parameters observed were number of shoots, length of shoots, number of leaves, and percentage of rooting shoots, at 3, 5, and 9 week after culture (WAC). The result showed that the use of 0,2 mg/l BA performed the best shoots growth multiplication with a relatively high rate of increased shoots num-ber and percentage of rooting shoots, at 3 to 9 WAC. Abundant shoots number (21.00 shoots), with length of shoots of 5.92 cm, leaves number of 13.00, and percentage of rooting shoots of 83.33% was obtained on MS + BA 0.2 mg/l, 9 WAC. 
Pengaruh Zat Pengatur Tumbuh Benzyl Adenin (BA) dan NAA Terhadap Pertumbuhan Temulawak (Curcuma Xanthoriza Roxb.) Secara in vitro Syahid, Sitti Fatimah; Hadipoentyanti, Endang
Buletin Penelitian Tanaman Rempah dan Obat Vol 13, No 2 (2002): Buletin Penelitian Tanaman Rempah dan Obat
Publisher : Pusat Penelitian dan Pengembangan Perkebunan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21082/bullittro.v13n2.2002.1-6

Abstract

Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

Abstract

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.
Callus Regeneration of Gynura procumbens (Lour.) Merr. In Vitro syahid, Sitti Fatimah; Seti, Lusia
Jurnal Biologi Universitas Andalas Vol 10 No 1 (2022)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.10.1.15-22.2022

Abstract

Gynura procumbens (Lour.) Merr. is one of the species of Asteraceae which is potential as medicinal. Propagation of the species could be conducted by vegetative, so the plant genetic variability is narrow. Genetic variability could be increased by somaclonal variation through callus culture. There is no report on in vitro regeneration from callus culture, although this method could assist further genetic improvement of plants. In this experiment, different concentrations of 2,4- D (0.1 ; 0.3 ; 0.5 mg L -1 ) singly or combination with BA (0.1 ; 0.3 and 0.5 mg L -1 ) were evaluated for callus induction and several concentrations of BA (0 ; 0.1; 0.5 and 1.0 mg -1 ) combination with kinetin (0.1 and 0.3 mg-1) were observed for ability of callus formed shoots. The results showed that the best media for callus induction was 0.5 mg L -1 2,4-D + 0.5 mg L -1 BA. This treatment produced friable callus structure, no roots and yellowish white. Callus regeneration was obtained on the combination of 0.1 mg L -1 BA. + 0.1 mg L -1 kinetin and 0.1 mg L -1 BA + 0.5 mg L -1 kinetin but the percentage was still low. Keywords: G procumbens {Lour.} Merr, induction, regeneration, calli, in vitro
Co-Authors Budi Martono Desriani Desriani Endang Hadipoentyanti Hadipoentyanti, Endang Hapsari, Betalini Widhi Haz, Aufa Rizqia Kumala, Ajeng Putri MIFTAKHUROHMAH MIFTAKHUROHMAH, MIFTAKHUROHMAH Natalini Nova Kristina Noorohmah, Siti NUR AJIJAH, NUR Nurliani Bermawie Otih Rostiana Rahayu, Resa Sri Raihan, Eldrian Daffa Rantau, Deritha Ellfy Seti, Lusia SUSI PURWIYANTI, SUSI Tias Arlianti Wulandari, Dyah Retno Yuliawati