Article Per Year (5 Year)
p-Index From 2020 - 2025
0.444
P-Index
This Author published in this journals
All Journal AGRIVITA, Journal of Agricultural Science Jurnal Penelitian Pendidikan IPA (JPPIPA)
Raihan, Eldrian Daffa
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Education Materials Science & Nanotechnology Physics

Published : 2 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search

 1 
Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

Abstract

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.
Isolation and Characterization of Pathogenic Mold Causing Potato Tuber Rot Disease Asharo, Rizal Koen; Indrayanti, Reni; Amala, Azizatul; Raihan, Eldrian Daffa; Tampanguma, Raymond Rayhand; Putri, Hilda Arsyah Eka; Pasaribu, Pinta Omas; Wardana, Nurul Assyifa
Jurnal Penelitian Pendidikan IPA Vol 10 No 4 (2024): April
Publisher : Postgraduate, University of Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jppipa.v10i4.6355

Abstract

The potato plant (Solanum tuberosum L.) is a perennial crop that contains high amounts of carbohydrates, minerals, and vitamins in its tubers, making it a carbohydrate-rich alternative food to rice or corn. One of the diseases that often appear on potato plants is potato rot caused by pathogenic molds. This study aims to isolate and characterize pathogenic fungi that cause blight on potato tubers based on Koch's Postulates. Potato pathogenic molds were isolated from potato tubers that had been rotted, then the molds were grown on PDA and purified twice. The purified isolates were then inoculated onto 30 healthy potato tubers and incubated for 7 days. Healthy potato tubers experienced the same symptoms as potato tuber rot. The isolated pathogenic fungi were then characterized so that the pathogenic fungi of Phytophthora infestans were obtained. In this study, Koch's Postulate method was successfully applied to isolate and characterize the pathogenic fungi that cause potato tuber rot. The pathogenic fungi caused a potato tuber rot disease incidence value of 100% with a disease severity value of 60.7%. The two factors that determine the disease incidence and disease severity values are internal factors (genes and traits of the pathogen) and external factors (environment).
Co-Authors Amala, Azizatul Desriani Desriani Hapsari, Betalini Widhi Haz, Aufa Rizqia Kumala, Ajeng Putri Noorohmah, Siti Pinta Omas Pasaribu Putri, Hilda Arsyah Eka Rahayu, Resa Sri Rantau, Deritha Ellfy Reni Indrayanti Rizal Koen Asharo Sitti Fatimah Syahid Tampanguma, Raymond Rayhand Wardana, Nurul Assyifa Wulandari, Dyah Retno Yuliawati