Article Per Year (5 Year)
p-Index From 2020 - 2025
0.888
P-Index
This Author published in this journals
All Journal Biosfer: Jurnal Tadris Biologi AGRIVITA, Journal of Agricultural Science Life Science and Biotechnology ASPIRATOR - Journal of Vector-Borne Diseases Studies Annales Bogorienses
Wulandari, Dyah Retno
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Education Health Professions Immunology & microbiology Medicine & Pharmacology Social Sciences Other

Published : 7 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 7 Documents
Search

 1 
Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

Abstract

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.
Development Of Google Site As An Interactive Learning Media Integrated With Islamic Values Wulandari, Dyah Retno; Sholihat, Neng; Purwanto, Hadi; Jehloh, Nurulhuda
Biosfer: Jurnal Tadris Biologi Vol 15 No 1 (2024): Biosfer: Jurnal Tadris Biologi
Publisher : UNIVERSITAS ISLAM NEGERI RADEN INTAN LAMPUNG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24042/biosfer.v15i1.19424

Abstract

The research of the study was to determine the feasibility of Google Site learning media integrated Islamic values by utilizing advances in technology and student perceptions. The type of research is R&D using the ADDIE model design. The subjects of this study were researchers, material, religious, and media experts, as well as 61 seventh-grade students of junior high school. The data collection technique is to use the interview method, observation and validation sheet, and response questionnaire. Data analysis is quantitative according to the ADDIE model development procedure. The results showed that the feasibility of the product from material expert validation obtained a score of 97%, religious expert validation 100%, media expert validation with a score of 96%, and educator practicality obtained 91% and 95% learner response. Based on the results obtained, the interactive learning media of the integrated solar system of Islamic values is feasible and practical to be used to help learn and add insight into the relationship of material with Islamic values at junior high school.ABSTRAK: Tujuan penelitian adalah untuk mengetahui kelayakan media pembelajaran google site diintegrasikan nilai-nilai islam dengan memanfaatkan kemajuan teknolog dan persepsi peserta didik. Jenis penelitian adalah R&D dengan menggunakan desain model ADDIE. Subjek penelitian ini yaitu peneliti, ahli materi, agama dan media, serta 61 peserta didik kelas VII sekolah menengah pertama. Teknik pengumpulan data adalah dengan menggunakan metode wawancara, observasi dan lembar validasi serta angket persepsi. Analisis data yaitu menggunakan deskriptif kuantitatif sesuai prosedur pengembangan model ADDIE. Hasil penelitian menunjukkan bahwa kelayakan produk dari validasi ahli materi memperoleh skor 97%, validasi ahli agama 100%, validasi ahli media dengan skor 96%, prktikalitas pendidik memperoleh 91% dan respon perserta didik 95%. Berdasarkan hasil yang diperoleh maka media pembelajaran interaktif sistem tata surya terintegrasi nilai-nilai islam layak dan praktis digunakan untuk membantu belajar dan menambah wawasan keterkaitan materi dengan nilai-nilai islam di sekolah menengah pertama.
Faktor Risiko Demam Berdarah di Negara Tropis: Risk Factors of Dengue Hemorrhagic Fever in Tropical Countries Ismah, Zata; Purnama, Tri Bayu; Wulandari, Dyah Retno; Sazkiah, Ema Rizka; Ashar, Yulia Khairina
Aspirator Vol 13 No 2 (2021): Jurnal Aspirator Volume 13 Nomor 2 2021
Publisher : Perkumpulan Entomologi Kesehatan Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22435/asp.v13i2.4629

Abstract

Abstract. Tropical countries are the largest contributor to the incidence of Dengue Hemorrhagic Fever (DHF), but research on risk factors is still independent in various countries, it cannot be concluded holistically. Through the research design, a systematic review is able to summarize and answer the causes of DHF in this tropical country. This research method is a systematic review with guidelines following the 2009 PRISMA Checklist. In the initial search, 1,680 articles were found using the keyword “risk factors for Dengue Hemorrhagic Fever”, reduced to 274 article titles after adding the keyword “tropical country”. Furthermore, the relevant abstracts were filtered and found 37 selected article items. Through critical appraisal of the full text of the article, it was found that 17 articles met the selection criteria for further review in this study. The results showed that there were 5 major groups of risk factors that were widely studied, namely sociodemography, climatology, place of dwelling, environment, and behavior. The sociodemographic factor associated with the incidence of DHF in tropical countries is age. In terms of climatology, temperature and rainfall are important factors in the vector breeding process. Rural areas (rural areas) are the place of dwelling with the most cases of DHF found. The environmental aspect that has been widely studied is mosquito breeding. The most significant risk behavior factor in transmission was the behavior of hanging clothes. Of the 17 articles, it was found that 77.8% of the articles examined environmental variables. Abstrak. Negara tropis menjadi penyumbang kasus terbesar terhadap kejadian demam berdarah dengue (DBD), namun penelitian faktor risiko DBD masih independen di berbagai negara, sehingga belum dapat disimpulkan secara holistik. Melalui desain penelitian systematic review mampu merangkum dan menjawab penyebab DBD di negara tropis tersebut. Metode penelitian ini adalah systematic review dengan pedoman mengikuti PRISMA Cheklist tahun 2009. Pada pencarian awal ditemukan sebanyak 1.680 artikelmenggunakan kata kunci “faktor risiko Deman Berdarah Dengue”, berkurang menjadi 274 judul artikel setelah penambahan kata kunci “tropical country”. Selanjutnya disaring abstrak yang relevan dan ditemukan 37 item artikel terpilih. Melalui critical aprasial teks artikel lengkap, didapatkan 17 artikel memenuhi kriteria seleksi untuk selanjutnya di-review dalam penelitian ini. Hasil penelitian didapatkan 5 kelompok besar faktor risiko yang banyak diteliti yaitu sosiodemografi, geografi, place of dwelling, lingkungan dan perilaku. Faktor sosiodemografi yang berhubungan dengan kejadian DBD di negara tropis adalah usia. Pada faktor klimatologi, suhu dan curah hujan yang merupakan faktor penting dalam proses perkembangbiakan vektor. Daerah rural (perdesaan) merupakan place of dwelling yang paling banyak ditemukan kasus DBD. Aspek lingkungan yang banyak diteliti adalah perindukan nyamuk. Faktor perilaku yang berisiko dalam penularan yang paling banyak ditemukan signifikan yaitu perilaku menggantung pakaian. Dari 17 artikel, ditemukan 77,8% artikel semuanya meneliti variabel lingkungan.
Poiploidy induction of Indonesian Black Rice Oryza sativa L. Var. Cempo Ireng with Bio-catharantine Kurniawan, Ludfi; Laili, Alvina Nur; Angraeni, Devi Silvia; ‘Ain, Salsabila Qurrotu; Wulandari, Dyah Retno; Ulum, Fuad Bahrul
Life Science and Biotechnology Vol. 1 No. 2 (2023): November 2023
Publisher : Department of Biology, Faculty Mahematics and Natural Sciences, University of Jember

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/lsb.v1i2.43753

Abstract

High demand on black rice Oryza sativa L. due to their high antioxydant content and better nutrition than the white rice. On the other hand this high price rice still less interest for the farmet to cultivate it. Therefore, improvement of plant characters was carried out through polyploid induction using the natural anti-mitotic compound bio-catharanthine. The purpose of this study was to test the effectiveness of bio-catharanthine in inducing polyploidy in Cemp ireng black rice. This study used a two-factor completely randomized design (CRD) method with three replications. The treatment factor of bio-catharanthine concentration was 1%, 1.5 %, 2 %, 2 %, 2.5 % and 3 % with the soaking time of 48 hours. The germination rate, ploidy level, stomatal size and density, and antioxidant were measuret to observed the characteristic of the mutan. The results showed that the treatments of 3 % bio-catharanthine enhanced the chromosome number of black rice Cempo ireng. Biocatharantine did not affected the germination rate through the treatments. Out mutants shows alternation on the stomatal size and density. The antioxidant of leaf sample did not changed after the treatment. Bio-catharanthine on high concentration migh be possible to be applied on polyploidy induction in black rice
Detection of Potyvirus Using RT-PCR and ACP-ELISA of Dioscorea Species and In Vitro Shoot Multiplication of the Virus Free Plants Wulandari, Dyah Retno; Ermayanti, Tri Muji
Annales Bogorienses Vol. 15 No. 2 (2011): Annales Bogorienses
Publisher : BRIN

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Detection of Potyvirus using Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and Antigen Coated Plate-Enzyme Linked Immunoabsorbent Assay (ACP-ELISA) for Dioscorea alata, Dioscorea hispida, and Dioscorea esculenta was conducted in order to establish in vitro culture of virus-free of these species. Plants were collected from Yogyakarta, Lampung, Pasuruan, Jakarta and Bogor. Total RNA of plants grown in a greenhouse was then isolated according to Simple Direct Tube (SDT) method. Total RNA from symptomatic leaf of Yard Long Bean (Vigna unguiculata) infected with Bean Common Mosaic Potyvirus (BCMV) was used as the positive control treatment. RT-PCR assay with degenerate primers MJ1(F) and MJ2(R) was used to identify the Potyviruses infecting Dioscorea. ACP-ELISA with antibodies specific to group Potyvirus was carried out to detect Potyvirus from leaves samples. The Dioscorea virus-free species was then cultured on modified MS medium. Shoot tips or internodes were used as explants. The results showed that using both RT-PCR and ACP-ELISA, all species tested were free from virus. The growth response of explants on MS medium was varied depending on the plant species and the concentration of BAP.
The Effect of Increase in NaCl Concentration on Growth and Proline Content of Purple Yam (Dioscorea alata L.) Grown In Vitro Martin, Andri Fadillah; Azizah, Farroh; Wulandari, Dyah Retno; Ermayanti, Tri Muji
Annales Bogorienses Vol. 16 No. 2 (2012): Annales Bogorienses
Publisher : BRIN

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Tuber of purple yam (Dioscorea alata L.) has been used as an alternative food in some areas in Indonesia. The tuber contains high carbohydrate, low glycemic index and gluten free, therefore, study on genetic improvement of this species is needed to increase the productivity and to find out new cultivars which can be cultivated in marginal lands. This research was aimed to investigate the effect of NaCl concentration on growth and proline content of purple yam grown in vitro. Shoot tips were cultured on MS (Murashige and Skoog) medium supplemented with NaCl at concentrations of 25; 50; 100; 200 and 250 mM. After six weeks in culture, height of shoots, number of nodes, number of leaves, as well as proline content were recorded. The results showed that shoots grown on MS medium supplemented with NaCl at 25 and 50 mM had better growth compared to control. The best medium for its growth was MS containing 50 mM of NaCl. Increase in NaCl level’s resulted in decrease of growth. The LD50 value was obtained at 183 mM of NaCl. The Highest proline concentration was achieved by shoots grown on the medium supplemented with 100 mM of NaCl. This result indicated that purple yam was tolerant to the increase of NaCl concentration up to 100 mM, on MS medium without addition of plant growth regulators.
In Vitro Induction of Tetraploid Pummelo ’Nambangan’ (Citrus maxima (Burm.) Merr.) by Colchicine Treatment Using Germinated Seed, Shoot Tip and Cotyledonary Node As Explants Wulandari, Dyah Retno; Purwito, Agus; Susanto, Slamet; Husni, Ali; Ermayanti, Tri Muji
Annales Bogorienses Vol. 19 No. 1 (2015): Annales Bogorienses
Publisher : BRIN

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Tetraploid citrus are important for interploidal hybridization to create triploid seedless citrus. Colchicine is the most commonly used as antimitotic agent to induce polyploid plants. Tetraploid induction by colchicine in Pummelo ‘Nambangan’ was conducted in vitro using different types of explants. The aim of this research was to induce tetraploid pummelo ‘Nambangan’ by colchicine treatment using germinated seed, shoot tip and cotyledonary node as explants. Tetraploid shoot induction was conducted by soaking germinated seeds, shoot tips and cotyledonary nodes in 0.1 % colchicine for 1, 3 and 5 hours. Regenerant shoots were grown on MS medium and their growth was observed after four weeks in culture. Ploidy level was determined using flow cytometry analysis. Stomata density, length and width of stomatal guard cell were also recorded. The results showed that shoot elongation was inhibited by colchicine treatment. Soaking of shoot tip explants in 0.1 % colchicine for 1 hour resulted in 66.66 % of putative tetraploid shoots. Compared to diploid shoots, tetraploids had lower stomata density but bigger in guard cell size.
Co-Authors Agus Purwito Ali Husni Angraeni, Devi Silvia Azizah, Farroh ‘Ain, Salsabila Qurrotu Desriani Desriani Fuad Bahrul Ulum Hapsari, Betalini Widhi Haz, Aufa Rizqia Jehloh, Nurulhuda Kumala, Ajeng Putri Kurniawan, Ludfi Laili, Alvina Nur Martin, Andri Fadillah Neng Sholihat Noorohmah, Siti Purnama, Tri Bayu Purwanto, Hadi Rahayu, Resa Sri Raihan, Eldrian Daffa Rantau, Deritha Ellfy Sazkiah, Ema Rizka Sitti Fatimah Syahid Slamet Susanto Tri Muji Ermayanti Yulia Khairina Ashar Yuliawati Zata Ismah