Article Per Year (5 Year)
p-Index From 2020 - 2025
0.61
P-Index
This Author published in this journals
All Journal AGRIVITA, Journal of Agricultural Science Jurnal Agro JURNAL BIOLOGI INDONESIA Annales Bogorienses
Hapsari, Betalini Widhi
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology

Published : 6 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 6 Documents
Search

 1 
PENGARUH MODIFIKASI KH2PO4, NH4NO3 DAN SUKROSA TERHADAP PERTUMBUHAN TUNAS SERTA PEMBENTUKAN UMBI MIKRO TAKA (TACCA LEONTOPETALOIDES) SECARA IN VITRO Rudiyanto, Rudiyanto; Hapsari, Betalini Widhi; Ermayanti, Tri Muji
JURNAL BIOLOGI INDONESIA Vol 14, No 1 (2018): JURNAL BIOLOGI INDONESIA
Publisher : Perhimpunan Biologi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14203/jbi.v14i1.3658

Abstract

ABSTRACTPolynesian arrowroot (Tacca leontopetaloides (L.) Kuntze), which is one of the bulbous herbaceous plants,have high nutritional value. Modification of macro nutrients by reducing nitrogen content and increasingphosphorus on the medium gave affects on shoot growth and initiated micro tuber formation on in vitrocultures. The aim of this research was to determine the effect of modified macro nutrients in combination withthe increase in sucrose concentrations on shoot growth and micro tuber formation of T. leontopetaloides. Theexperimental design was factorial completely randomized design.The factors tested were modifications of MSmacro nutrients that were. M1 (170 mg/l KH2PO4 and 1650 mg/l NH4NO3; normal, control treatment); M2 (340mg/l KH2PO4 and 825 mg/l NH4NO3); and M3 (680 mg/l KH2PO4 and 412.5 mg/l NH4NO3 in combinationwith 30 (S1) (control treatment), 40 (S2), 50 (S3) and 60 g/l of sucrose (S4). The variables tested were shootheight, number of leaves, number of roots and number of micro tuber which were observed weekly at 0-8weeks after culturing. The results showed that the modification of macro nutrient in combination with sucroseconcentration had significant effect on shoot height, number of leaves and number of roots but not significanton the number of tubers. The highest shoots were found in M1S3 treatment, the highest number of leaves wasin M1S1 and M1S3 treatment and the highest number of roots was in M1S4 treatment. The number of tubersnot significantly different between the treatments tested.Keywords: in vitro, KH2PO4, microtuber, NH4NO3, sucrose, Tacca leontopetaloides
Pengaruh peningkatan suhu pada fase pembentukan umbi tanaman kentang (Solanum tuberosum) cv. Granola Pantouw, Carla Frieda; Hapsari, Betalini Widhi; Hastilestari, Bernadetta Rina
Jurnal AGRO Vol 9, No 1 (2022)
Publisher : Jurusan Agroteknologi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/18117

Abstract

Kentang (Solanum tuberosum) merupakan salah satu bahan makanan yang penting di dunia. Budidaya komoditas ini umumnya berada di dataran tinggi dengan suhu yang rendah. Jumlah lahan pertanian di dataran tinggi semakin kecil disebabkan antara lain karena alih fungsi lahan. Penanaman kentang di dataran yang lebih rendah menjadi kendala karena adanya peningkatan suhu. Penelitian ini dirancang untuk mengetahui pengaruh ketinggian tempat dan perubahan suhu terhadap tanaman kentang pada fase pembentukan umbi. Tanaman kontrol ditanam pada ketinggian 2921 meter diatas permukaan laut (m dpl) dengan suhu siang/malam (190C/120C). Setelah fase pembentukan umbi, sebagian tanaman dipindah ke daerah dengan ketinggian 115 m dpl dengan suhu siang/malam (300C/240C). Perubahan ketinggian tempat dengan suhu yang berbeda mengakibatkan shade avoidance, perubahan akumulasi biomasa pada batang tanaman dan penurunan hasil panen. Hal ini disebabkan karena penurunan hasil fotosintesa, sukrosa, serta kadar klorofil yang disebabkan oleh faktor genetik dan metabolisme enzim. Oleh karena untuk mendukung permintaan komoditas kentang yang semakin meningkat, pemuliaan tanaman kentang tahan terhadap cekaman suhu diperlukan untuk memperluas area penanaman kentang di dataran menengah maupun dataran rendah.ABSTRACTPotato (Solanum tuberosum) is one of the important staple foods in the world. This plant is mostly cultivated in high-altitude regions with low temperatures. As the number of lands for potato cultivation is getting smaller due to land conversion. Potato cultivation in low-altitude regions with high temperatures yields low productivity. This study was designed to determine the effect of altitude and temperature changes on potato plants in the tuber formation phase. Control plants were planted in an area with an altitude of 2921 meters above sea level (m asl), with day/night temperatures (190C/120C). After the tuber formation phase, some plants were transferred to areas with an altitude of 115 m above sea level and day/night temperatures (300C/240C). Change in altitude with different temperatures resulted in shade avoidance, changes in the accumulation of biomass on plant stems, and yield reduction. This is due to decreasing sucrose content as photosynthesis assimilates, and chlorophyll content due to genetic factors and enzyme metabolism. Therefore, to support the increasing demand for potato commodities, breeding potato plants resistant to heat stress is needed to expand the potato planting area in middle or low altitudes. 
Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

Abstract

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.
Pengaruh peningkatan suhu pada fase pembentukan umbi tanaman kentang (Solanum tuberosum) cv. Granola Pantouw, Carla Frieda; Hapsari, Betalini Widhi; Hastilestari, Bernadetta Rina
Jurnal AGRO Vol. 9 No. 1 (2022)
Publisher : Jurusan Agroteknologi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/18117

Abstract

Kentang (Solanum tuberosum) merupakan salah satu bahan makanan yang penting di dunia. Budidaya komoditas ini umumnya berada di dataran tinggi dengan suhu yang rendah. Jumlah lahan pertanian di dataran tinggi semakin kecil disebabkan antara lain karena alih fungsi lahan. Penanaman kentang di dataran yang lebih rendah menjadi kendala karena adanya peningkatan suhu. Penelitian ini dirancang untuk mengetahui pengaruh ketinggian tempat dan perubahan suhu terhadap tanaman kentang pada fase pembentukan umbi. Tanaman kontrol ditanam pada ketinggian 2921 meter diatas permukaan laut (m dpl) dengan suhu siang/malam (190C/120C). Setelah fase pembentukan umbi, sebagian tanaman dipindah ke daerah dengan ketinggian 115 m dpl dengan suhu siang/malam (300C/240C). Perubahan ketinggian tempat dengan suhu yang berbeda mengakibatkan shade avoidance, perubahan akumulasi biomasa pada batang tanaman dan penurunan hasil panen. Hal ini disebabkan karena penurunan hasil fotosintesa, sukrosa, serta kadar klorofil yang disebabkan oleh faktor genetik dan metabolisme enzim. Oleh karena untuk mendukung permintaan komoditas kentang yang semakin meningkat, pemuliaan tanaman kentang tahan terhadap cekaman suhu diperlukan untuk memperluas area penanaman kentang di dataran menengah maupun dataran rendah.ABSTRACTPotato (Solanum tuberosum) is one of the important staple foods in the world. This plant is mostly cultivated in high-altitude regions with low temperatures. As the number of lands for potato cultivation is getting smaller due to land conversion. Potato cultivation in low-altitude regions with high temperatures yields low productivity. This study was designed to determine the effect of altitude and temperature changes on potato plants in the tuber formation phase. Control plants were planted in an area with an altitude of 2921 meters above sea level (m asl), with day/night temperatures (190C/120C). After the tuber formation phase, some plants were transferred to areas with an altitude of 115 m above sea level and day/night temperatures (300C/240C). Change in altitude with different temperatures resulted in shade avoidance, changes in the accumulation of biomass on plant stems, and yield reduction. This is due to decreasing sucrose content as photosynthesis assimilates, and chlorophyll content due to genetic factors and enzyme metabolism. Therefore, to support the increasing demand for potato commodities, breeding potato plants resistant to heat stress is needed to expand the potato planting area in middle or low altitudes. 
Comparison of the Reduction Effect of Sucrose and Table Sugar Concentration on Growth Characteristics of Red Ginger (Zingiber officinale Rocs.) Cultured in Liquid Medium Hapsari, Betalini Widhi; Ermayanti, Tri Muji; Rantau, Deritha E.; Rudiyanto, Rudiyanto
Annales Bogorienses Vol. 15 No. 1 (2011): Annales Bogorienses
Publisher : BRIN

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The aim of this research was to compare the reduction effect of sucrose or table sugar concentration on growth characteristics of red ginger cultured in MS liquid medium. Shoots of red ginger was cultured on MS liquid medium without addition of plant growth regulators, supplemented with 5, 10, and 20 g/l of sucrose or table sugar for 8 weeks. Resulted plantlets were acclimatized in a greenhouse to investigate their growth and survival rate. Numbers of stomata, chlorophyll concentration as well as cross section of leaves from plantlets grown in vitro were compared to those of transplants grown in the greenhouse. The results showed that the use of table sugar at concentration of 20 g/l gave the best growth of red ginger. Meanwhile, the reduction of table sugar from 20 to 10 g/l reduced growth and survival rate of in vitro shoots as well as that of transplants in the greenhouse. Only few shoots formed roots when they were grown on the medium containing 5 g/l of table sugar, and transplants failed to grow in the greenhouse. It found that the chlorophyll content of in vitro plantlets was lower than those of transplants grown in the glasshouse. However, the number of stomata of the in vitro plantlets was higher than that of transplants grown in the glasshouse. There was no anatomical abnormalities found on the cross section of leaves between in vitro plantlets and transplants grown in the greenhouse. The replacement of sucrose with table sugar may reduce the production cost of plantlets.
Response of Increasing NaCl Concentrations on Growth and Proline Content of Tacca leontopetaloides cultured in vitro Martin, Andri Fadillah; Hapsari, Betalini Widhi; Ermayanti, Tri Muji
Annales Bogorienses Vol. 19 No. 1 (2015): Annales Bogorienses
Publisher : BRIN

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The effects of increasing NaCl concentrations on growth and proline content of Tacca leontopetaloides cultured in vitro were investigated. T. leontopetaloides were suspected to have high tolerance against salinity, thus the purpose of this research was to investigate the effect of increasing NaCl concentrations added on growth medium on growth and proline content of T. leontopetaloides grown in vitro. In vitro corms were cultured on MS medium supplemented with NaCl at concentrations of 0, 10, 25, 50, 75, 100, 150 and 200 mM, respectively. After six weeks in culture, shoots height, shoots number, leaves number, fresh weight, as well as their proline content were recorded. The results showed that fresh weight of shoots grown on MS medium supplemented with 10, 25 and 75 mM NaCl was higher compared to the control treatment. Fresh weight decreased when shoots were cultured on MS medium supplemented with NaCl at more than 100 mM. Proline content increased along with the increase of NaCl concentrations. Meanwhile, the height of shoots, number of shoots, and number of leaves decreased along with the increase of NaCl concentrations.
Co-Authors Desriani Desriani Hastilestari, Bernadetta Rina Haz, Aufa Rizqia Ida Ayu Putu Sri Widnyani Kumala, Ajeng Putri Martin, Andri Fadillah Noorohmah, Siti Pantouw, Carla Frieda Rahayu, Resa Sri Raihan, Eldrian Daffa Rantau, Deritha E. Rantau, Deritha Ellfy Rudiyanto Rudiyanto, Rudiyanto Sitti Fatimah Syahid Tri Muji Ermayanti Wulandari, Dyah Retno Yuliawati