cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
suranto
Contact Email
editors@smujo.id
Phone
-
Journal Mail Official
editors@smujo.id
Editorial Address
unsjournals@gmail.com
Location
Kota surakarta,
Jawa tengah
INDONESIA
Biodiversitas Journal of Biological Diversity
Published by Universitas Sebelas Maret
ISSN : 1412033X     EISSN : 20854722     DOI : https://doi.org/10.13057/biodiv/d230231
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
The Biodiversitas Journal was first published in 2000 by the Department of Biology, FMNS, Universitas Sebelas Maret, Surakarta, Indonesia, then in 2006 it was co-published by the Society for Indonesian Biodiversity and that department; since 2017 it was also hosted by Smujo. From 2003-2012 it was accredited by DGHE, Ministry of Education, R.I., since 2014 was indexed by Scopus, where DOAJ and Google Scholar was indexed first.
Arjuna Subject : Biokimia, Genetika dan Biologi Molekuler - Biokimia, Genetika dan Biologi Molekuler (Lain-Lain)
Articles 6,269 Documents
 473   474   475   476   477 
Diversity and morphological characteristics of flowers in reticulatus, inodorus, and makuwa group melon (Cucumis melo) HELFI EKA SAPUTRA; MUHAMAD SYUKUR; WILLY BAYUARDI SUWARNO; SOBIR SOBIR
Biodiversitas Journal of Biological Diversity Vol. 25 No. 7 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250735

Abstract

Abstract. Saputra HE, Syukur M, Suwarno WB, Sobir. 2024. Diversity and morphological characteristics of flowers in reticulatus, inodorus, and makuwa group melon (Cucumis melo). Biodiversitas 25: 3130-3137. Characterization of melon (Cucumis melo L.) flowers is useful for crossing. This research aimed to obtain information about the diversity and morphological characteristics of melon flowers in the reticulatus, inodorus, and makuwa groups. Fifteen genotypes from 3 groups (5 genotypes each) were tested. There were 8 flower characters observed. Principal component and cluster analysis have been used to calculate similarity coefficients. Grouping based on flower characters was divided into 4 groups with a diversity of 52.7%. There are no morphological characteristics of flowers to characterize each group of melons. The reticulatus group has flower characteristics as follows: NMFP of 5-5.4 petals, NHFP of 5-5.2 petals, SLMF of 0.95-2.9 cm, SLHF of 0.36-1.98 cm, DMFS of 1.01-1.34 mm, DHFS of 2.57- 3.15 mm, DMF of 3.12-4.99 cm, and DHF of 8.03-8.61 cm. The inodorus group has flower characteristics as follows: NMFP of 4-5 petals, NHFP of 5 petals, SLMF of 1.34-3.18 cm, SLHF of 0.7-2.46 cm, DMFS of 1.16-1.61 mm, DHFS of 2.72-2.94 mm, DMF of 3.47-4.34 cm, and DHF of 6.56-8.15 cm. The makuwa group has flower characteristics as follows: NMFP of 5-8 petals, NHFP of 5-6 petals, SLMF of 1.32-1.98 cm, SLHF of 1.04-1.74 cm, DMFS of 1.07-1.36 mm, DHFS of 2.67- 3.86 mm, DMF of 3.31-3.85 cm, and DHF of 7.16-8.35 cm.
Potential use of phytochemical from ethanolic extract of green seaweed Ulva reticulata in aquaculture NURBETY TARIGAN; AGUS O. SUDRAJAT; HARTON ARFAH; ALIMUDDIN ALIMUDDIN; DINAMELLA WAHJUNINGRUM
Biodiversitas Journal of Biological Diversity Vol. 24 No. 12 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d241248

Abstract

Abstract. Tarigan N, Sudrajat AO, Arfah H, Alimuddin A, Wahjuningrum D. 2023. Potential use of phytochemical from ethanolic extract of green seaweed Ulva reticulata in aquaculture. Biodiversitas 24: 6868-6879. Ulva reticulata is green seaweed with potential phytochemical properties in the aquaculture sector. Therefore, this study aims to determine phytochemical components and evaluate the toxicity of Ulva reticulata ethanolic extract on aquatic animals. The primary constituents in the sample were extracted using the maceration method with 96% ethanol. The antioxidant activity was evaluated using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) method, while toxicity level was determined using the Brine Shrimp Lethal Test (BSLT) method at concentrations of 0, 10, 100, 300, 500, 1000, and 2000 mg L-1. The results showed that Ulva reticulata ethanolic extract was qualitatively composed of alkaloids, flavonoids, saponins, tannins, phenols, and steroids with mid (++), low (+), low (+), low (+), low (+), and mid (++) activity levels, respectively. Based on quantitative analysis, the sample was composed of sitosterol (19.01 mg g-1), stigmasterol (35.00 mg g-1), saponins (17.04 mg g-1), flavonoids (82.16 mg QE 100 g-1), total phenols (144.00 g QE 100 g-1), and tannins (49.03 mg g-1). Furthermore, Ulva reticulata ethanolic extract had a strong antioxidant level with a 50% inhibitory concentration (IC50) of 53.00 ppm. The toxicity test showed that the 50% lethal concentration (LC50) of the sample was 481.86 mg L-1. These results showed that Ulva reticulata ethanolic extract was a non-toxic material with a high potential for phytochemical properties that could be beneficial for fish growth, reproduction, and health.
Ethnobotanical study of peraq api ritual in Sasak Tribe of Lombok Island, Indonesia and its potential for sustainable tourism SLAMET MARDIYANTO RAHAYU; JATI BATORO; KURNIASIH SUKENTI; LUCHMAN HAKIM
Biodiversitas Journal of Biological Diversity Vol. 24 No. 10 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d241030

Abstract

Abstract. Rahayu SM, Batoro J, Sukenti K, Hakim L. 2023. Ethnobotanical study of peraq api ritual in Sasak Tribe of Lombok Island, Indonesia and its potential for sustainable tourism. Biodiversitas 24: 5485-5494. Peraq api is a ritual for giving baby names by the Sasak Tribe in Lombok Island, Indonesia. This ritual uses various species of plants and processions to symbolize values and beliefs of the Sasak people. This unique cultural knowledge and practice might interest tourists to experience the ritual. This study aims to determine the diversity of plant species used in peraq api ritual and the ethnobotanical knowledge embedded on it, and to assess the potential of utilizing this ritual for sustainable tourism development. This research was conducted in villages around the Mandalika Area, including Sengkol, Kuta, Sukadana, and Mertak Villages, located in Pujut Sub-district, Central Lombok District, West Nusa Tenggara Province. The research was carried out by combining the methods of direct observation, participatory observation and interviews. Information on the species and vernacular names, plant part used, mode of use, conservation status of the plant as well as its habitat were collected and analyzed using descriptive and qualitative approaches. Based on the research, it was found that 15 families, 21 genera and 22 plant species were used in peraq api ritual. Each plant symbolizes the indigenous value and beliefs of Sasak Tribe related to their connection with God, people and environment. The use of plants in peraq api ritual also shows the indigenous intelligence of the Sasak Tribe. Traditional knowledge about the uses of plants and landscape management plays an important role in plant conservation. Plants used in the peraq api ritual can be found in various habitats, including homegarden, garden, riverside and ricefield. These various habitats resemble the indigenous ecological and ethnobotanical knowledge of Sasak Tribe in landscape management which has a very positive role in conserving biodiversity, creating a sustainable environment and socio-cultural preservation. The peraq api ritual has the potential to be develope as a sustainable tourism. The development of peraq api rituals for tourism might be useful to preserve cultural values of Sasak Tribe ??as a national cultural asset, conserve plant diversity and environment and improve the welfare of local communities.
Ethnopharmacology of medicinal plants used by the Tenggerese community in Bromo Tengger Semeru National Park, Indonesia WEKA SIDHA BHAGAWAN; WIWIED EKASARI; MANGESTUTI AGIL
Biodiversitas Journal of Biological Diversity Vol. 24 No. 10 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d241028

Abstract

Abstract. Bhagawan WS, Ekasari W, Agil M. 2023. Ethnopharmacology of medicinal plants used by the Tenggerese community in Bromo Tengger Semeru National Park, Indonesia. Biodiversitas 24: 5464-5477. Bromo Tengger Semeru National Park is a repository of biodiversity with profound cultural significance. The Tenggerese community residing within the park possesses rich ethnopharmacological knowledge, using medicinal plants for various ailments. This study aims to comprehensively explore the medicinal plant diversity, traditional uses, and potential pharmacological activities among the Tenggerese people. Ethnopharmacological data was gathered through interviews with informants in seven Tenggerese villages. Ethnopharmacological indices like Species Use Value (SUV) and Fidelity Level (FL) were calculated to identify the most important medicinal plants. Phytochemical analysis of selected medicinal plants was conducted using UPLC-QTOF-MS/MS, and its pharmacological potential was assessed through antibacterial tests. A total of 124 medicinal plant species from 54 families were documented. The Tenggerese community utilizes plants to treat diverse diseases, with reproductive healthcare being prominently featured. Elaeocarpus longifolius emerged as a key species with high SUV and FL values. Phytochemical analysis identified 25 compounds, including major and minor compounds, already known for their pharmacological activities elsewhere. Elaeocarpus longifolius extract showed inhibitor activity against both gram-positive and gram-negative bacteria. The findings contribute to bridging traditional knowledge and modern scientific research, offering potential avenues for the development of drug candidates from indigenous medicinal plants.
Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling M. HAFIZHUL IMAN; PARAMITA CAHYANINGRUM KUSWANDI; SENA ADI SUBRATA
Biodiversitas Journal of Biological Diversity Vol. 25 No. 1 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250141

Abstract

Abstract. Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling. Biodiversitas 25: 355-360. Rusa deer is a vulnerable species with a large geographic range but natively inhabits Java and Bali. Despite the wide distribution, its native population is declining, raising a concern about a small population's adverse genetic effect. It encourages genetic studies to provide baseline data that has been vacant recently. This research aimed to demonstrate an application of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This research also aimed to provide genetic variation of the native deer population as baseline data. The research sites were Baluran, Alas Purwo in East Java, and Bali Barat national parks from which fecal samples were collected. Moreover, 20 DNA samples were isolated from the feces using a kit (Dneasy PowerSoil Pro from Qiagen) and amplified at the control region gene using a forward: AAACCAGAAAAGGAGAGCAAC and a reverse: TCATCTAGGCATTTTCAGTGCC primer. The amplicons were sequenced, and the number of Haplotypes (Hn), Haplotype diversity (Hd), nucleotide diversity (p), site polymorphism, and phylogeographic tree were determined. The result showed that all the sequences had coverage of 100% and identity >98% with the Rusa timorensis sequence available in the GenBank. Furthermore, we found Hn = 11, Hd = 0.88, p = 0.005 and 30 site polymorphisms. Therefore, compared to an introduced population, the Rusa deer has a richer Hd and higher site polymorphism but a poorer p. Furthermore, we found that the Baluran population had high Hd, p, and is possibly forming a distinct clade.
Fungal diversity associated with the decomposition of Avicennia marina leaf litter at various salinity levels YUNASFI YUNASFI; IPANNA ENGGAR SUSETYA; BUDI UTOMO; AFIFUDDIN DALIMUNTHE; SAMSURI SAMSURI; ANITA ZAITUNAH
Biodiversitas Journal of Biological Diversity Vol. 25 No. 2 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250239

Abstract

Abstract. Yunasfi, Susetya IE, Utomo B, Dalimunthe A, Samsuri, Zaitunah A. 2024. Fungal diversity associated with the decomposition of Avicennia marina leaf litter at various salinity levels. Biodiversitas 25: 792-800. The process of litter decomposition in mangrove ecosystem is influenced by both biological and environmental factors. Biological factors include organisms, such as worms, snails, bacteria, and fungi, while environmental factors are soil, water pH, salinity, and others. Therefore, this study aimed to determine the effect of salinity level and length of decomposition period, dominant fungi, as well as carbohydrate and protein levels in Avicennia marina leaf litter. In the experiment, litter bags containing 50 g of A. marina leaf litter were used and placed at salinity levels of <10 ppt, 11-20 ppt, and 21-30 ppt. The results showed that the highest decomposition rate i.e., 6.90/year, with length of time = 0.15 years was found in A. marina leaf litter at a salinity level of 21 ppt-30 ppt. At salinity levels of <10 and 10-20 ppt, the decomposition rate was 4.55 and 5.91, respectively, while the litter period in soil was 0.22 and 0.17 years. Furthermore, the residual leaf litter decomposed at salinity levels of <10 ppt, 11-20 ppt, and 21-30 ppt was 6.67 g, 4.57 g, and 4.36 g, respectively. The average value of the Shannon diversity Index for fungal species in A. marina leaf litter, which had experienced decomposition ranged from low to moderate. At salinity levels of <10 ppt, 10-20 ppt, and 20-30 ppt, the values obtained were 1.96, 1.86, and 1.95 respectively. The fungal species diversity index was greater than the control, 1.26. Based on the results, A. marina leaf litter placed at salinity level of <10 ppt had the highest carbohydrate and protein content of 12.10 and 9.12%, respectively, while the lowest protein content of 8.28% was recorded at salinity level of 20-30 ppt. This study showed that the longer the decomposition period at various levels of salinity, the higher the protein content in absolute terms.
Diversity of actinomycetes on plant rhizosphere of karst ecosystem of Gorontalo, Indonesia YULIANA RETNOWATI; NOVRI YOULA KANDOWANGKO; ABUBAKAR SIDIK KATILI; WAWAN PEMBENGO
Biodiversitas Journal of Biological Diversity Vol. 25 No. 3 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250301

Abstract

Abstract. Retnowati Y, Kandowangko NY, Katili AS, Pembengo W. 2024. Diversity of actinomycetes on plant rhizosphere of karst ecosystem of Gorontalo, Indonesia. Biodiversitas 25: 907-915. The objective of this study was to isolate and identify the actinomycetes associated with the rhizosphere of plants in the karst ecosystem. This study was descriptive-quantitative. Soil sampling was conducted at three locations of the karst ecosystem of Gorontalo, i.e., Bangga Hills at Bangga Bubaa Coastal area of Gorontalo District, Hills around Lake Limboto of Gorontalo District, and Oluhuta Beach Hills at Bone Bolango District. Rhizosphere-soil sample was collected from 15-30 cm of soil depth. Isolation of actinomycetes was performed using the plate method. The screening of phosphate-solubilizing bacteria was based on the ability to solubilize phosphates indicated by the clear zone on the Pikovskaya medium. Identification of actinomycetes bacteria based on morphology and molecular characters. The morphology character included the color of aerial and substrate mycelium. Molecular characteristics based on the sequence of 16S rRNA gene compared to sequence data on the gene bank of NCBI. The phylogenetic tree reconstruction was based on the Neighbor-joining algorithm. The results successfully found six isolates, including three actinomycetes isolates, two non-actinomycetes bacteria, and one yeast. They were isolated from the rhizosphere of Malastoma malabathrum, Chromolaena odorata, Cycas rumphii, Leucaena leucocephala, and Jatropha curcas. The actinomycetes isolate showed plant-growth-promoting potential indicated by solubilizing phosphate and Indole 3-Acetic Acid production activities. Based on the molecular analysis, actinomycetes were closely related to Streptomyces aegyptia (MT505707.1:42-1426), Streptomyces sp. GGCR-6 (MH718844.1:5-1391), and Streptomyces carpaticus strain PES-A23 (MH712039).
Species of aphids found in ornamental and wild plants in Pagar Alam District, South Sumatra, Indonesia CHANDRA IRSAN; ERISE ANGGRAINI; WENNY RAMADHANI
Biodiversitas Journal of Biological Diversity Vol. 24 No. 12 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d241222

Abstract

Abstract. Irsan C, Anggraini E, Ramadhani W. 2023. Species of aphids found in ornamental and wild plants in Pagar Alam District, South Sumatra, Indonesia. Biodiversitas 24: 6602-6612. Aphids are one of the crucial pests in tropical and sub-tropical regions. The presence of aphids in a plant can be very detrimental due to their role as vectors. Aphids exhibit species diversity, but not much information has been reported about the species diversity of aphids associated with essential crops such as ornamental plants. Furthermore, many aphid species, such as wild plants, were found on plants that were not hosts. Therefore, this study reported the species of aphids found in ornamental and wild plants. The field research employed purposive and direct observation to inventory cultivated or wild plants hosting and collecting aphids. The plant selection process included cultivated plants encompassing ornamental plants and wild plants or weeds. The collection and identification of host plants and aphids involved systematic searches for the selected plants and subsequent examination for the presence of aphids. Observations were made to all existing plant species to find those colonized by aphids. This study revealed that a total of 15 species of aphids were found in Ornamental plants, Aphis craccivora Koch, 1854, Aphis spiraecola Patch, 1914, Aphis glycines Matsumura, 1917, Aphis gossypii Glover, 1877, Aulacorthum solani Kaltenbach, 1843, Macrosiphoniella sanborni Gillette, 1908, Macrosiphum rosae Linnaeus, 1758, Myzus persicae Sulzer, 1776, Neomyzus circumflexus Buckton, 1876, Pentalonia caladii van der Goot, 1917, Rhopalosiphum nymphaeae Linnaeus, 1761, Sinemegoura citricola van der Goot, 1917, Toxoptera aurantii Boyer de Fonscolombe, 1841, Toxoptera citricidus Kirkaldy, 1907, Toxoptera odinae van der Goot, 1917 and the total of 11 species aphids found in weeds, A. gossypii, A. craccivora, A. glycines, A. citricola, Greenidea sp., Hystroneura setariae Thomas, 1878, Hiperomyzus sp., Lipaphis erysimi Kaltenbach, 1843, Rhopalosiphum maidis Fitch, 1856, Rhopalosiphum padi Linnaeus, 1758, Schizaphis rotundiventris Signoret, 1860.
The preference of insect predators on several types of flowering plants as insectary plant in cayenne pepper fields KIRANA FADHILAH; BAMBANG TRI RAHARDJO; MOCHAMMAD SYAMSUL HADI
Biodiversitas Journal of Biological Diversity Vol. 24 No. 11 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d241139

Abstract

Abstract. Fadhilah K, Rahardjo BT, Hadi MS. 2023. The preference of insect predators on several types of flowering plants as insectary plant in cayenne pepper fields. Biodiversitas 24: 6177-6183. Cayenne pepper (Capsicum frutescens L.) is a popular commodity yet often suffers from reduced yields due to pest attacks. Therefore, growing this plant requires environmentally friendly management. One of the measures is using the baby blue eyes (Nemophila menziesii) plant. Baby blue eyes are promising insectary plants since they attract predatory insects. This study, which was conducted in Kasin Village, Karangploso, Malang, from March to June 2023, aimed to explore the predatory insects' diversities and preferences in cayenne pepper fields by comparing baby blue eyes as insectary plants with common zinnias and marigolds. The research comprised four treatments: P1. Control; P2. Cayenne peppers + baby blue eyes; P3. Cayenne peppers + common zinnias (Zinnia elegans); and P4. Cayenne peppers + marigolds (Tagetes erecta). The study revealed lady beetle Coccinella transversalis, Menochilus sexmaculatus, and big-eyed bug Geocoris sp. as the most abundant predatory insects with increasing populations across the treatments. The highest predator insect diversity was found in the Cayenne pepper + baby blue eyes (P2) treatment. In conclusion, baby blue eyes attract more predatory insects in cayenne pepper fields than other insectary plants, making them valuable alternatives besides common zinnias and marigolds. These findings provide a reference for future studies to promote baby blue eyes as insectary plants for farmers.
Effect of endophytic entomopathogenic fungal conidia and blastospores induced in maize plants by seed inoculation on Spodoptera frugiperda immune response and mortality JELLY MILINIA PUSPITA SARI; SITI HERLINDA; SUWANDI SUWANDI; ELFITA ELFITA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 10 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d241053

Abstract

Abstract. Sari JMP, Herlinda S, Suwandi S, Elfita. 2023. Effect of endophytic entomopathogenic fungal conidia and blastospores induced in maize plants by seed inoculation on Spodoptera frugiperda immune response and mortality. Biodiversitas 24: 5709-5717. Endophytic entomopathogenic fungi (EPF) can produce conidia and blastospores; however, the pathogenicity of conidia and blastospores inoculated in plants on Spodoptera frugiperda larvae is limited. This research aimed to detect the effect of the endophytic entomopathogenic fungal conidia and blastospores induced in maize plants by seed inoculation on S. frugiperda's immune response and mortality. A total of 10 isolates of endophytic EPF were used in this experiment. The study revealed that 9 days after treatments, S. frugiperda larvae consuming maize leaves inoculated with blastospores of endophytic entomopathogenic fungi; their hemocyte concentration did not show any significant differences between the fungal treatments and control. However, 1 up to 7 days after treatments, the concentration significantly differed from the control. Furthermore, B. bassiana JgSPK, JaGiP, and JaSpkPGA(2) isolates tended to be the most pathogenic compared to other isolates. Feeding on leaves colonized by endophytic EPF could reduce the larval and pupal weight of S. frugiperda. The percentage of S. frugiperda non-emergence pupae from larvae-eating maize leaves colonized with B. bassiana JgSPK and JaGiP isolates was significantly higher than other fungal treatments and the control. The endophytic entomopathogenic fungal conidia and blastospores inoculated in maize plants by seed inoculation have a lethal effect on S. frugiperda larvae. However, exposure to conidia and blastospores did not reduce or increase the hemocyte concentration in the larvae hemolymph of S. frugiperda.

Page 475 of 627 | Total Record : 6269

 473   474   475   476   477 

Filter by Year

2000 2026


Reset
Filter By Issues
All Issue Vol. 27 No. 6 (2026) Vol. 27 No. 5 (2026) Vol. 27 No. 4 (2026) Vol. 27 No. 3 (2026) Vol. 27 No. 2 (2026) Vol. 27 No. 1 (2026) Vol. 26 No. 12 (2025) Vol. 26 No. 11 (2025) Vol. 26 No. 10 (2025) Vol. 26 No. 9 (2025) Vol. 26 No. 8 (2025) Vol. 26 No. 7 (2025) Vol. 26 No. 6 (2025) Vol. 26 No. 5 (2025) Vol. 26 No. 4 (2025) Vol. 26 No. 3 (2025) Vol. 26 No. 2 (2025) Vol. 26 No. 1 (2025) Vol. 25 No. 12 (2024) Vol. 25 No. 11 (2024) Vol. 25 No. 10 (2024) Vol. 25 No. 9 (2024) Vol. 25 No. 8 (2024) Vol. 25 No. 7 (2024) Vol. 25 No. 6 (2024) Vol. 25 No. 5 (2024) Vol. 25 No. 4 (2024) Vol. 25 No. 3 (2024) Vol. 25 No. 2 (2024) Vol. 25 No. 1 (2024) Vol. 24 No. 12 (2023) Vol. 24 No. 11 (2023) Vol. 24 No. 10 (2023) Vol. 24 No. 9 (2023) Vol. 24 No. 8 (2023) Vol. 24 No. 7 (2023) Vol. 24 No. 6 (2023) Vol. 24 No. 5 (2023) Vol. 24 No. 4 (2023) Vol. 24 No. 3 (2023) Vol. 24 No. 2 (2023) Vol. 24 No. 1 (2023) Vol. 23 No. 12 (2022) Vol. 23 No. 11 (2022) Vol. 23 No. 10 (2022) Vol. 23 No. 9 (2022) Vol. 23 No. 8 (2022) Vol. 23 No. 7 (2022) Vol. 23 No. 6 (2022) Vol. 23 No. 5 (2022) Vol. 23 No. 4 (2022) Vol. 23 No. 3 (2022) Vol. 23 No. 2 (2022) Vol. 23 No. 1 (2022) Vol. 22 No. 12 (2021) Vol. 22 No. 11 (2021) Vol. 22 No. 10 (2021) Vol. 22 No. 9 (2021) Vol. 22 No. 8 (2021) Vol. 22 No. 7 (2021) Vol. 22 No. 6 (2021) Vol. 22 No. 5 (2021) Vol. 22 No. 4 (2021) Vol. 22 No. 3 (2021) Vol. 22 No. 2 (2021) Vol. 22 No. 1 (2021) Vol. 21 No. 12 (2020) Vol. 21 No. 11 (2020) Vol. 21 No. 10 (2020) Vol. 21 No. 9 (2020) Vol. 21 No. 8 (2020) Vol. 21 No. 7 (2020) Vol. 21 No. 6 (2020) Vol. 21 No. 5 (2020) Vol. 21 No. 4 (2020) Vol. 21 No. 3 (2020) Vol. 21 No. 2 (2020) Vol. 21 No. 1 (2020) Vol. 20 No. 12 (2019) Vol. 20 No. 11 (2019) Vol. 20 No. 10 (2019) Vol. 20 No. 9 (2019) Vol. 20 No. 8 (2019) Vol. 20 No. 7 (2019) Vol. 20 No. 6 (2019) Vol. 20 No. 5 (2019) Vol. 20 No. 4 (2019) Vol. 20 No. 3 (2019) Vol. 20 No. 2 (2019) Vol. 20 No. 1 (2019) Vol. 19 No. 6 (2018) Vol. 19 No. 5 (2018) Vol. 19 No. 4 (2018) Vol. 19 No. 3 (2018) Vol. 19 No. 2 (2018) Vol. 19 No. 1 (2018) Vol. 18 No. 4 (2017) Vol. 18 No. 3 (2017) Vol. 18 No. 2 (2017) Vol. 18 No. 1 (2017) Vol. 17 No. 2 (2016) Vol. 17 No. 1 (2016) Vol. 16 No. 2 (2015) Vol. 16 No. 1 (2015) Vol. 15 No. 2 (2014) Vol. 15 No. 1 (2014) Vol. 14 No. 2 (2013) Vol. 14 No. 1 (2013) Vol. 13 No. 4 (2012) Vol. 13 No. 3 (2012) Vol. 13 No. 2 (2012) Vol. 13 No. 1 (2012) Vol. 12 No. 4 (2011) Vol. 12 No. 3 (2011) Vol. 12 No. 2 (2011) Vol. 12 No. 1 (2011) Vol. 11 No. 4 (2010) Vol. 11 No. 3 (2010) Vol. 11 No. 2 (2010) Vol. 11 No. 1 (2010) Vol. 10 No. 4 (2009) Vol. 10 No. 3 (2009) Vol. 10 No. 2 (2009) Vol. 10 No. 1 (2009) Vol. 9 No. 4 (2008) Vol. 9 No. 3 (2008) Vol. 9 No. 2 (2008) Vol. 9 No. 1 (2008) Vol. 8 No. 4 (2007) Vol. 8 No. 3 (2007) Vol. 8 No. 2 (2007) Vol. 8 No. 1 (2007) Vol. 7 No. 4 (2006) Vol. 7 No. 3 (2006) Vol. 7 No. 2 (2006) Vol. 7 No. 1 (2006) Vol. 6 No. 4 (2005) Vol. 6 No. 3 (2005) Vol. 6 No. 2 (2005) Vol. 6 No. 1 (2005) Vol. 5 No. 2 (2004) Vol. 5 No. 1 (2004) Vol. 4 No. 2 (2003) Vol. 4 No. 1 (2003) Vol. 3 No. 2 (2002) Vol. 3 No. 1 (2002) Vol. 2 No. 2 (2001) Vol. 2 No. 1 (2001) Vol. 1 No. 2 (2000) Vol. 1 No. 1 (2000) More Issue