cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Brigitta Laksmi Paramita
Contact Email
brigitta.laksmi@uajy.ac.id
Phone
+6282329549978
Journal Mail Official
journal.biota@gmail.com
Editorial Address
Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia
Location
Kota yogyakarta,
Daerah istimewa yogyakarta
INDONESIA
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati
Published by Universitas Atma Jaya Yogyakarta
ISSN : 25273221     EISSN : 2527323X     DOI : doi.org/10.24002/biota
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati merupakan jurnal ilmiah yang memuat hasil-hasil penelitian, kajian-kajian pustaka dan berita-berita terbaru tentang ilmu dan teknologi kehayatian (biologi, bioteknologi dan bidang ilmu yang terkait). Biota terbit pertama kali bulan Juli 1995 dengan ISSN 0853-8670. Biota terbit tiga nomor dalam satu tahun (Februari, Juni, dan Oktober).
Arjuna Subject : Ilmu Pertanian dan Biologi (Semua) - Ilmu Pertanian dan Biologi (Lain-Lain)
Articles 1,193 Documents
 87   88   89   90   91 
Kajian Awal Pemanenan Siput Laut (Gastropoda) di Pantai Krakal, Yogyakarta: II. Aktivitas Pemanen Felicia Zahida; Mastok B. Sinulingga; Wibowo N. Jati
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 10, No 1 (2005): February 2005
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v10i1.2795

Abstract

A preliminary study on marine snails harvest (Gastropods) has been done in Krakal beach, Yogyakarta, during October to December 2003. Krakal beach has become an under-pressure habitat since tourism industry occurred all over Indonesia. Marine snails have been harvested for over two decade in this area but there is no study regarding this activity yet. This study aims to elucidate the harvester’s knowledge about simple conservation and activities such as the way of harvesting, the intensity of harvesting and the income generating from harvesting gastropods.
Pengaruh Pemberian BAP dan NAA terhadap Pertumbuhan Krisan (Chrysanthemum morifolium, Ram.) dalam Kultur Jaringan Yohana Theresia Maria Astuti; Neny Andayani
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 10, No 1 (2005): February 2005
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v10i1.2796

Abstract

The objective of this study was to evaluate the effect of combination benzyl amino purine(BAP) and naphtalene acetid acid (NAA) on tissue culture of Chrysanthemum. Theexperiment was conducted at The Tissue Culture Laboratory, Agriculture Faculty,Stiper Agriculture Institute. The Completely Randomized Design was applied in thisexperiment, consisting of two factors; those were BAP and NAA application. Each factorconsisted of four treatments. Each combination of treatment was carried out with ninereplications. The conclusion from this study were: Application of higher BAP and NAAconcentration increased budding of explant, whereas application of higher NAA thanBAP concentration increased the growth of bud and leaf number, also increased rootingof explant.
Pertumbuhan Kaempferia rotunda L. dengan Perlakuan Variasi Jumlah Umbi Semu dan Penambahan Pupuk Organik Ning Wikan Utami
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 10, No 1 (2005): February 2005
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v10i1.2797

Abstract

Kaempferia rotunda, usually called as temu putih is belonging into Zingiberaceae family.This plant has been used as traditional medicine for curing diarrhoe and disentry.Objective of the study was to determine the effect of pseudo tubers number and organicfertilizers on the productivity of K. rotunda. Research was conducted in TreubLaboratory, Research Centre for Biology LIPI, Bogor, from July 2002 until April 2003.The experiment was arranged in a factorial Randomized Block Design. The treatmentsconsisted of two factors, i.e the first factor were number of pseudo tubers (0, 2 and 4)and second factor were organic fertilizers (soil, goat manure and compost).The result of the exsperiment showed that both factors, i.e number of pseudo tubers andorganik fertilizers significantly affect productivity of K.rotunda. The effect of goatmanure more dominant than compost. The interaction of those two factors significantlyinfluenced number of leaves and fresh weight of rhizome. The best results was on thecombination treatment of two pseudo tubers and goat manure which had the highestvalue on all peubahs observed which were increased growth and yield of K. rotundasignificantly.
Kecocokan Jenis Inang dan Pemberian Pupuk Kandang terhadap Pertumbuhan Semai Cendana (Santalum album L. ) Kuswanto Kuswanto
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 10, No 1 (2005): February 2005
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v10i1.2798

Abstract

The purpose of this research was find out the effects of three host plants and three levels of natural fertilizer on sandalwood seedling growth. This natural relationship between host plant and sandalwood seedling was conducted recognize the characteristic of seedling growth was studied. The parameters were height, diameter, and haustoria number.The research was conducted in factorial experiment arranged in CRD. The treatment consisted of two factors, namely effect of host plant and stable fertilizer. The first factor consisted four kinds of host plants were : a/ control; b/ Cabe rawit ; c/ Turi; and d/ Lamtoro, while the second factor were four levels of stable fertilizer : a/ control; b/ 200 g/pot; c/ 300 g/pot, and d/ 400g/pot.Three replicates was employed in the research.The result of the research indicated that most of different host plant and stable fertilizer treatments were significant effect on sandalwood seedling growth. After five months, the highest growth of Sandalwood seedling treatment with turi and stable fertilizer 400 g/pot was 44.92 cm , and 38.41 cm with host plant cabe rawit and stable fertilizer 300 g/pot. While the lowest was 12.80 cm produced by control (without host plant and fertilizer ). The diameter growth of sandalwood seedling treatment with turi and stable fertilizer 400 g/pot was 3,09 mm, and 3,30 mm with cabe rawit and stable fertilizer 400 g/pot. The houstoria number of sandalwood seedling treatment with turi was 75 and 71 with cabe rawit. In terms of determined the relationship between Sandalwood and its host plants were first turi , second cabe rawit, and lamtoro gung.
Keragaman Daerah Kontrol DNA Mitokondria Rusa Timor (Cervus timorensis timorensis) di Pulau Timor, Alor, dan Pantar M. Syamsul Zein
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2799

Abstract

A study on mtDNA control region diversity of the timor deer was conducted in EastNusa Tenggara Province. Sample consisted of 20 individuals from 3 islands (Timor,Pantar, and Alor). Total DNA were extracted from leucocyte (buffy coat). Fragmentcontrol region of the mitochondrial DNA were amplified by Polymerase ChainReaction (PCR) using primers of forward primer5”AAACCAGAAAAGGAGAGCAAC3” and reverse primer5”TCATCTAGGCATTTTCAGTGCC3”. Nucleotide sequence of the mitochondrialcontrol region were aligned by using ClastalX and phylogenetic analyses by Neighbor-Joining methode. Kimura two-parameter model of nucleotide substitution usingpairwise distance calculation program was implemented with the Mega softwareversion 3. The purposes of this study, were to examine the control region (D-Loop) ofthe mitochondrial DNA and to discuss the phylogeography of the Cervus timorensistimorensis in East Nusa Tenggara Province. Results indicated that from 435 basenucleotide sequences, 16 polymorphic sites with 8 haplotypes were found among 3islands. Haplotype diversity and nucleotide diversity were 0.056 and 0.039. DNAdistances values ranged from 0.014 to 0.021.
Identifikasi Awal Bakteri pada Juwana Trochus niloticus Linn. dan Tridacna squamosa Linn. Asal Hatchery Pulau Barrang Lompo Makassar Magdalena Litaay; Risco B. Gobel; As’adi Abdullah; Subair Subair
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2800

Abstract

The research on early identification of bacterial from juveniles top shell (Trochus niloticus L.) and giant clam (Tridacna squamosa Linn.) was conducted at Unhas’s hatchery at Barrang Lompo island during August-October 2006. Bacteriology test was done at Microbiology Laboratory of Biology Department, Math and Science Faculty, Hasanuddin University, Makassar. The quantitative test was done using Most Probable Number (MPN) and Standard Plate Count (SPC) methods. While the qualitative test included bacteria colony observation, macroscopic, microscopic, and biochemical test. Macroscopic observation was done by assessing the form, elevation, color, ridge, and inner structure of bacterial colony. Microscopic observation was conducted by using Gram and spora stain. The result of MPN method shows the average total bacteria for juveniles top shell is 17.5 x 102 cell/ml and for giant clam is 6.65 x 102 cell/ml, while SPC results indicate the average total bacteria for juveniles top shell is 4.8 x 105 cell/ml and for giant clam is 3.0 x 105 cell/ml, respectively. The result of biochemical test identifies 5 genera of bacteria such as Micrococcus, Bacillus, Streptomyces, Escherichia and Enterobacter.
Studi Pakan Burung Perkici Pelangi (Trichoglossus haematodus Linnaeus, 1771) dalam Laboratorium Penangkaran W. Widodo
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2801

Abstract

During the 2002-2003 period, the research was done to study 11 Rainbow Lorikeets reared in an animal house laboratory. The aim of this research was to find the food rations formule of the Rainbow Lorikeets so that those birds can be able to grow and breed well. The food rations were composed of 26.3% local bird foods (521), 35.09% lampung bananas, 8.77% slice corns, 10.5% boiled quails eggs, 1.75% white bread, bean sprouts and red sugar are 8.77%, respectively. All of food materials were mixed on the plastic cup and mixed with 450 ml of water, then pulverized like sweet porridge. That porridge was given to birds in cafeteria and the water was made ready “ad libitum” everyday. The results have shown that giving food rations formula can stimulate two pairs of the Rainbow Lorikeets breeding and during the 2002-2003 period they produced three young birds.
Penambahan Tepung Cangkang Udang dalam Pakan Buatan Sebagai Penguat Warna Ikan Koi (Cyprinus carpio L.) Arry Yusnita Saloh; Yuniarti Aida; Felicia Zahida
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 10, No 1 (2005): February 2005
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v10i1.2802

Abstract

Shrimp’s skin and carapace has been used as color enhancement. The shrimp’s skinand carapace was pounded into flour and added to the commercial pellet availablelocally. The shrimp’s flours contains red pigmen astaxanthine. The Koi’s used in thisexperiment were two months old Cyprinus carpio L var kohaku. Five level of differentconcentration of shrimp’s flour were used i.e. 5.7%, 8.5%, 11.4%, 14.2%, and 17.1%respectively. Each aquarium contains three fishes were used in threeplicate and rearedfor 8 weeks. Five main color or hue was observed i.e. Redish Orange, Pastel Orange,Orange Red or Yellowish Red, Red and High Red or Vivid Red. 15 panelis have beenused to give their comments to the color enhancement. The results shows that the valueof the fish’s color didn’t change much, but the chrome intensity increase on week eight.Statistical analysis of Kruskall-Wallis and Mann-Whitney Test shows that on theconcentration of shrimp flour of 11,4% was giving the best value for hue and chrome.On the consentration of 14,2% and 17,1% the results were not strong enough. This isprobably because the concentration of the flour reaches maximum at 11,4% and givingmaksimum color enhancement level so that more additioing didn’t gave any change.
Model Pertumbuhan Populasi untuk Pengendalian Populasi Akasia Berduri (Acacia nilotica (L.) Willd. Ex Del.) di Taman Nasional Baluran Supriyadi Supriyadi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2803

Abstract

The savannas in Baluran National Park have been severely invaded by Acacia nilotica. The invasion reduced grazing areas and created wildlife watching problems for tourists. Therefore, population control management should be developed. The aim of the study was to construct a population growth model in relation to the control of the population in the park. The model was an age structured one which consisted of seed class, age class <1 year, age class 1-<2 years, age class 2-<3 years, age class 3-<4 years, and age class 4 years. It was assumed that a temporary seed bank exists; there is no seed dormancy; seeds are produced by age class 4 years; and the number of seedlings is determined by available space. The population size was expressed as the number of individuals per hectare. The population control scenario included effects of complete elimination and partial elimination in the first year. Each of those was combined with seed harvesting. The total population growth pattern generated by the model was similar to the logistic one but with a bit oscillation before a stable population size was reached. More important parameters in the model were germination rate, seedling survival rate, number of seeds per individuals, maximum population size, and survival rate of age class 4. The simulation results showed that control measures of the population were effective when seed harvesting was carried out. A periodic partial elimination combined with seed harvesting might be useful. Seed harvesting should be applied every year to retard the growth and to prevent the spread of A. nilotica populations in the savannas.
Kajian Penanda Genetik Tarsius bancanus dan Tarsius spectrum dengan Sekuen D-Loop Parsial DNA Mitokondria Rini Widayanti; Dedi Duryadi Solihin
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2804

Abstract

The objective of this research was to study the specific genetic marker on D-loop region of Tarsius bancanus and Tarsius spectrum. The sequencing of PCR product using primer DLTARPROF on D-loop resulted in base sequence of 270 nts. Result of D-loop fragments sequencing was put on multiple alignment with other primates from Genbank with the aid of software Genetyc-Win Version 3.0 and Clustal W, and was analyzed using MEGA program version 3.1. The genetic distance was based on nucleotide D-loop, the smallest genetic distance was 0% and the biggest was 11.8% and the average was 2.3%. The phylogenetic tree using neighbor Joining Method based on some nucleotide sequence on D-loop region could not be used to differentiate between Tarsius bancanus and Tarsius spectrum.

Page 89 of 120 | Total Record : 1193

 87   88   89   90   91 

Filter by Year

2003 2026


Reset
Filter By Issues
All Issue Vol 11, No 1 (2026): February 2026 Vol 10, No 3 (2025): October 2025 Vol 10, No 2 (2025): June 2025 Vol 10, No 1 (2025): February 2025 Vol 9, No 3 (2024): October 2024 Vol 9, No 2 (2024): June 2024 Vol 9, No 1 (2024): February 2024 Vol 8, No 3 (2023): October 2023 Vol 8, No 2 (2023): June 2023 Vol 8, No 1 (2023): February 2023 Vol 7, No 3 (2022): October 2022 Vol 7, No 2 (2022): June 2022 Vol 7, No 1 (2022): February 2022 Vol 6, No 3 (2021): October 2021 Vol 6, No 2 (2021): June 2021 Vol 6, No 1 (2021): February 2021 Vol 5, No 3 (2020): October 2020 Vol 5, No 2 (2020): June 2020 Vol 5, No 1 (2020): February 2020 Vol 4, No 3 (2019): October 2019 Vol 4, No 2 (2019): June 2019 Vol 4, No 1 (2019): February 2019 Vol 4, No 1 (2019): February 2019 Vol 3, No 3 (2018): October 2018 Vol 3, No 2 (2018): June 2018 Vol 3, No 1 (2018): February 2018 Vol 3, No 1 (2018): February 2018 Vol 2, No 3 (2017): October 2017 Vol 2, No 2 (2017): June 2017 Vol 2, No 1 (2017): February 2017 Vol 2, No 1 (2017): February 2017 Vol 1, No 3 (2016): October 2016 Vol 1, No 2 (2016): June 2016 Vol 1, No 1 (2016): February 2016 Vol 1, No 1 (2016): February 2016 Vol 19, No 1 (2014): February 2014 Biota Volume 19 Nomor 1 Tahun 2014 Biota Volume 13 Nomor 2 Tahun 2014 Vol 18, No 2 (2013): June 2013 Vol 18, No 1 (2013): February 2013 Biota Volume 18 Nomor 1 Tahun 2013 Vol 17, No 3 (2012): October 2012 Vol 17, No 2 (2012): June 2012 Vol 17, No 1 (2012): February 2012 BIOTA Volume 17 Nomor 3 Tahun 2012 Vol 16, No 2 (2011): June 2011 Vol 16, No 2 (2011): June 2011 Vol 16, No 1 (2011): February 2011 Vol 16, No 1 (2011): February 2011 Vol 15, No 3 (2010): October 2010 Vol 15, No 2 (2010): June 2010 Vol 15, No 1 (2010): February 2010 Vol 14, No 3 (2009): October 2009 Vol 14, No 2 (2009): June 2009 Vol 14, No 1 (2009): February 2009 Vol 13, No 3 (2008): October 2008 Vol 13, No 2 (2008): June 2008 Vol 13, No 1 (2008): February 2008 Vol 12, No 3 (2007): October 2007 Vol 12, No 2 (2007): June 2007 Vol 12, No 1 (2007): February 2007 Vol 11, No 3 (2006): October 2006 Vol 11, No 2 (2006): June 2006 Vol 11, No 1 (2006): February 2006 Vol 10, No 3 (2005): October 2005 Vol 10, No 2 (2005): June 2005 Vol 10, No 1 (2005): February 2005 Vol 9, No 3 (2004): October 2004 Vol 9, No 2 (2004): June 2004 Vol 9, No 1 (2004): February 2004 Vol 8, No 3 (2003): October 2003 Vol 8, No 2 (2003): June 2003 Vol 8, No 1 (2003): February 2003 More Issue