cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 12 Documents
Search results for , issue "Vol 11, No 2 (2006)" : 12 Documents clear
Apoptosis and Phagocytosis Activity of Macrophages Infected by Mycobacterium tuberculosis Resistant and Sensitive Isoniazid Clinical Isolates Rachmawaty, Farida J.; Wibawa, Tri; Soesatyo, Marsetyawan H.N.E.
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Mycobacterium tuberculosis (M.tb) is the main causative pathogen that cause the pulmonary tuberculosis.Intracellular M.tb was reported able to induce macrophages apoptosis, which may have crucial role in the regulationof immun response against M.tb infection. As an intracellular bacteria, M.tb able to live and replicate withinmacrophages. Phagocytosis is the first step to achieved this condition. The induction of macrophages apoptosis byINH resistant and sensitive M.tb clinical isolates, and H37Rv was studied. The macrophages apoptosis level weremeasured using an Ag-capture ELISA for histone and fragmented DNA (Cell Death Detection ELISAplus, RocheDiagnostic GmBH). Phagocytosis activity also analyzed, after staining using fluorescence dye (AcriFluorTM, ScientificDevice Lab.). The results showed that there was no significantly different between INH resistant and sensitive M.tbclinical isolates in respect their ability to induce apoptosis. The phagocytosis activity among the clinical isolates wasshown to be strain dependent, and undistinguishable between the Mtb clinical isolates. There was no associationbetween macrophages apoptosis level and the phagocytosis activity. These data suggested that among the virulentMtb clinical isolates, the ability to induce macrophages apoptosis and phagocytosis were consistently in comparablelevelKeywords: Mycobacterium tuberculosis, apoptosis, phagocytosis, macrophages, isoniazid
Production and Extraction Of Antibacterial Bacteriocin from Pediococcus sp. NWD 015 Harmayani, Eni; N, Nofisulastri; Bachruddin, Zaenal
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (147.738 KB)

Abstract

objectives were to study the growth pattern of Pediococcus sp. NWD 015 and bacteriocin activity, extractionand characterization of bacteriocin, and to determine the effect of storage time and temperature on bacteriocinactivity. Results showed that the bacteriocin activity increased during growth and reached the highest activity duringstationary phase. The maximum bacteriocin production reached after incubation of the cell for 12 h at 37oC in TGEbroth and decreased after 96 h incubation. Extraction with adsorbtion-desorbtion method could increased a specificactivity of bacteriocin. Bacteriocin from Pediococcus sp. NWD 015 is inactivated by Proteinase-K; however it is stillactive by heat treatment at 121oC for 15 min and over pH 2 – 11. Bacteriocin of Pediococcus sp. NWD 015 was effectiveagaints Enterococcus faecalis, Staphylococcus aureus, Eschericia coli, Listeria monocytogenes but not against Salmonellathypimurium. The molecular weight of bacteriocin is 4.95 kDa.Keywords : Bacteriocins, Pediococcus sp NWD 015.
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
Reactive Oxygen Intermediate (ROI) in Dog Macrophage Infected with Mycobacterium tuberculosis Tjahajati, Ida
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (151.109 KB)

Abstract

experiment used 24 healthy dogs, aged between 1 and 2 years, both male and female which were divided into twodifferent groups consisting of 12 dogs each. The first group was the treatment group, that is they were infected with Mtuberculosis and the second one was the control group. The activity of macrophages ROI secretion were measured at1st, 2nd, 12th, and 24th after infection using nitroblue tetrazolium (NBT) reduction assay. Three cats were used to measure themacrophage activity in each period, using triplicate sample for each cat. The results of the experiment showed thatROI secretion increased in infected group compared with the control group, and this activity reached to the plateaulevel at 2 weeks after infection. Although these enhanced activities were gradually diminished thereafter, higherlevels of these activities were consistently observed until the end of experiment compared with control group. Theresults of the experiment indicated that ROI played an important role to against M.tuberculosis infection in dogs.Keyword: macrophage, ROI, M.tuberculosis, dogs
Rapid Detection and Molecular Typing of Dengue Virus by Using Multiplex-Nested-RT-PCR Wijayanti, Nastiti; Wibawa, Tri; Nirwati, Hera; Haryanto, Aris; S, Sutaryo1
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (140.369 KB)

Abstract

world. We have evaluated the combination of one-step RT-PCR and multiplex nested PCR assays for detectingdengue viruses from clinical samples. Twelve patients were screened for the dengue virus, using a pair of primersthat conserve for several Flavivirus. The results showed that in 12 suspect patients, 100% were positive for Flavivirusand there are some genotypic variation among them, that indicated by several RT-PCR products higher than 511 bp,the expected product for RT-PCR. Further assay was performed to clarify the presence and serotypes of dengue virususing multiplex nested PCR. Serotyping results indicated that 83,3% of samples can be confirmed for dengue virus.Among the dengue virus positive 16,7 % are dengue-2, 16.7 % are dengue-3, and the most common 50% are dengue-4,whereas dengue-1 were not found among the patients. The combination of RT-PCR and multiplex nested PCR assaycan be used for rapid analysis dengue samples in early phase which is potentially useful for clinical, epidemiologyand also evolutionary studies.Key words: Flavivirus, dengue virus, serotype, RT-PCR, multiplex nested PCR
The Efficacy of Fucoidan on Gastric Ulcer Juffrie, Mohammad; Rosalina, Ina; Damayanti, Wahyu; Djumhana, Ali; A, Ariani; Ahmad, Harjono
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (263.732 KB)

Abstract

Hyperacidity causes gastric injury, and in severe situations, ulcer could develop. The growth factors known asthe basic fibroblast growth factor (bFGF) and the epidermal growth factor (EGF) have been recognized to promoteulcer healing. Fucoidan is extracted from a brown seaweed of Okinawa called Mozuku or Cladosiphon okamuranus.Fucoidan is effective for the healing of gastric ulcers by inducing epithelial cells to produce growth factors. The aimof this study is to explore the efficacy of fucoidan in patient who suffered by gastric ulcer. A randomized control trialdouble blind was conducted to 33 eligible samples. By using four-blocks random samples were divided into fucoidanand placebo groups. 100 mg of fucoidan was given to the fucoidan group and 100 mg of glucose was given to theplacebo group. Due to ethical reasons, for both groups were given a proton pump inhibitor. There was no differencein the age category between the fucoidan group (mean: 46.23 ± 14.8 years) and the placebo group (mean: 46.18 ± 18.4years) (p: 0.28). There was also no difference in sex between the fucoidan group (female: 10/33; male 7/33) and theplacebo group (female: 7/33; male: 9/33); p: 0.38. According to the SAKITA and MIWA criterias 32 patients fulfilledA1 which indicate active severe ulcer, and 1 patient fulfilled A2 which indicate active moderate ulcer. Most of theulcers were gastric ulcer. There was a significant improvement of the grade of ulcer in fucoidan group (94%) (16/17)compared to placebo group (37.5%) (6/16,p: 0.005). There was a significant reduction of abdominal pain after 5 daysin the fucoidan group, compared to the placebo group (p: 0.04). Vomiting tends to decrease in day 6 of the fucoidangroup however its proportion is similar with that of the placebo group (p: 0.9). Fucoidan is effective for ulcer healingand reducing ulcer symptoms.Key words : fucoidan, gastric ulcer, anti-peptic activity
The Efficacy of Fucoidan on Gastric Ulcer Mohammad Juffrie; Ina Rosalina; Wahyu Damayanti; Ali Djumhana; A. Ariani; Harjono Ahmad
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (263.732 KB) | DOI: 10.22146/ijbiotech.7565

Abstract

Hyperacidity causes gastric injury, and in severe situations, ulcer could develop. The growth factors known asthe basic fibroblast growth factor (bFGF) and the epidermal growth factor (EGF) have been recognized to promoteulcer healing. Fucoidan is extracted from a brown seaweed of Okinawa called Mozuku or Cladosiphon okamuranus.Fucoidan is effective for the healing of gastric ulcers by inducing epithelial cells to produce growth factors. The aimof this study is to explore the efficacy of fucoidan in patient who suffered by gastric ulcer. A randomized control trialdouble blind was conducted to 33 eligible samples. By using four-blocks random samples were divided into fucoidanand placebo groups. 100 mg of fucoidan was given to the fucoidan group and 100 mg of glucose was given to theplacebo group. Due to ethical reasons, for both groups were given a proton pump inhibitor. There was no differencein the age category between the fucoidan group (mean: 46.23 ± 14.8 years) and the placebo group (mean: 46.18 ± 18.4years) (p: 0.28). There was also no difference in sex between the fucoidan group (female: 10/33; male 7/33) and theplacebo group (female: 7/33; male: 9/33); p: 0.38. According to the SAKITA and MIWA criterias 32 patients fulfilledA1 which indicate active severe ulcer, and 1 patient fulfilled A2 which indicate active moderate ulcer. Most of theulcers were gastric ulcer. There was a significant improvement of the grade of ulcer in fucoidan group (94%) (16/17)compared to placebo group (37.5%) (6/16,p: 0.005). There was a significant reduction of abdominal pain after 5 daysin the fucoidan group, compared to the placebo group (p: 0.04). Vomiting tends to decrease in day 6 of the fucoidangroup however its proportion is similar with that of the placebo group (p: 0.9). Fucoidan is effective for ulcer healingand reducing ulcer symptoms.Key words : fucoidan, gastric ulcer, anti-peptic activity
Production and Extraction Of Antibacterial Bacteriocin from Pediococcus sp. NWD 015 N. Nofisulastri; Zaenal Bachruddin; Eni Harmayani
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (147.738 KB) | DOI: 10.22146/ijbiotech.7566

Abstract

objectives were to study the growth pattern of Pediococcus sp. NWD 015 and bacteriocin activity, extractionand characterization of bacteriocin, and to determine the effect of storage time and temperature on bacteriocinactivity. Results showed that the bacteriocin activity increased during growth and reached the highest activity duringstationary phase. The maximum bacteriocin production reached after incubation of the cell for 12 h at 37oC in TGEbroth and decreased after 96 h incubation. Extraction with adsorbtion-desorbtion method could increased a specificactivity of bacteriocin. Bacteriocin from Pediococcus sp. NWD 015 is inactivated by Proteinase-K; however it is stillactive by heat treatment at 121oC for 15 min and over pH 2 – 11. Bacteriocin of Pediococcus sp. NWD 015 was effectiveagaints Enterococcus faecalis, Staphylococcus aureus, Eschericia coli, Listeria monocytogenes but not against Salmonellathypimurium. The molecular weight of bacteriocin is 4.95 kDa.Keywords : Bacteriocins, Pediococcus sp NWD 015.
Rapid Detection and Molecular Typing of Dengue Virus by Using Multiplex-Nested-RT-PCR Nastiti Wijayanti; Hera Nirwati; Tri Wibawa; Aris Haryanto; S. Sutaryo
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (140.369 KB) | DOI: 10.22146/ijbiotech.7569

Abstract

world. We have evaluated the combination of one-step RT-PCR and multiplex nested PCR assays for detectingdengue viruses from clinical samples. Twelve patients were screened for the dengue virus, using a pair of primersthat conserve for several Flavivirus. The results showed that in 12 suspect patients, 100% were positive for Flavivirusand there are some genotypic variation among them, that indicated by several RT-PCR products higher than 511 bp,the expected product for RT-PCR. Further assay was performed to clarify the presence and serotypes of dengue virususing multiplex nested PCR. Serotyping results indicated that 83,3% of samples can be confirmed for dengue virus.Among the dengue virus positive 16,7 % are dengue-2, 16.7 % are dengue-3, and the most common 50% are dengue-4,whereas dengue-1 were not found among the patients. The combination of RT-PCR and multiplex nested PCR assaycan be used for rapid analysis dengue samples in early phase which is potentially useful for clinical, epidemiologyand also evolutionary studies.Key words: Flavivirus, dengue virus, serotype, RT-PCR, multiplex nested PCR
Apoptosis and Phagocytosis Activity of Macrophages Infected by Mycobacterium tuberculosis Resistant and Sensitive Isoniazid Clinical Isolates Farida J. Rachmawaty; Tri Wibawa; Marsetyawan H.N.E. Soesatyo
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.7570

Abstract

Mycobacterium tuberculosis (M.tb) is the main causative pathogen that cause the pulmonary tuberculosis.Intracellular M.tb was reported able to induce macrophages apoptosis, which may have crucial role in the regulationof immun response against M.tb infection. As an intracellular bacteria, M.tb able to live and replicate withinmacrophages. Phagocytosis is the first step to achieved this condition. The induction of macrophages apoptosis byINH resistant and sensitive M.tb clinical isolates, and H37Rv was studied. The macrophages apoptosis level weremeasured using an Ag-capture ELISA for histone and fragmented DNA (Cell Death Detection ELISAplus, RocheDiagnostic GmBH). Phagocytosis activity also analyzed, after staining using fluorescence dye (AcriFluorTM, ScientificDevice Lab.). The results showed that there was no significantly different between INH resistant and sensitive M.tbclinical isolates in respect their ability to induce apoptosis. The phagocytosis activity among the clinical isolates wasshown to be strain dependent, and undistinguishable between the Mtb clinical isolates. There was no associationbetween macrophages apoptosis level and the phagocytosis activity. These data suggested that among the virulentMtb clinical isolates, the ability to induce macrophages apoptosis and phagocytosis were consistently in comparablelevelKeywords: Mycobacterium tuberculosis, apoptosis, phagocytosis, macrophages, isoniazid

Page 1 of 2 | Total Record : 12


Filter by Year

2006 2006