Garuda - Garba Rujukan Digital

Article Per Year (5 Year)

All

Indonesian Journal of Biotechnology

ijbiotech
Website

Published by Universitas Gadjah Mada

ISSN : 08538654 EISSN : 20892241 DOI : -

Core Subject : Science,

Biochemistry, Genetics & Molecular Biology Immunology & microbiology Materials Science & Nanotechnology

The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.

Arjuna Subject : -

Articles 530 Documents

32 33 34 35 36

Effect of Culture Medium Supplementation with b-mercaptoethanol and Amino Acid on Canine Intergeneric Embryo Development with Porcine Oocyte Cytoplasm Recipient Yuda Heru Fibrianto
Indonesian Journal of Biotechnology Vol 12, No 1 (2007)
Publisher : Universitas Gadjah Mada

The present study investigated the effect of culture medium supplementation with mercaptoethanol ( ME)and amino acid (AA) on canine intergeneric embryo development with porcine oocyte cytoplasm. Porcine cumulusoocyte complexes (COCs) were collected from slaughterhouse and matured in TCM-199 supplemented with 26.2mM NaHCO, 3.05 mM glucose, 0.91 mM sodium pyruvate, 0.57 mM L-cysteine, 75 mg/l kanamycin, 10 ng/ml 3epidermal growth factor, equine chorionic gonadotropin (eCG), 10 IU/ml human chorionic gonadotropin (hCG),and 10% (v/v) porcine follicular fluid (pFF) at 39 °C in a humidified atmosphere of 5% CO for 42-44 h and donor cell 2collected from ear skin afghanhound male dog. After somatic cell nuclear transfer (SCNT), embryo developmentwere examined for cleavage rate and 144 hr for final development after cultured in media. The result shows that,amino acid and mercapoethanol addition in culture medium (NCSU-23) have no effect on embryo development.The development rate of embryo until 16 cell stage in NCSU and NCSU supplement are 4.67% and morula stage are3.73% and 4.67%.Key words : intergeneric clone embryo, canine, ( amino acid (AA)

PGV-1 is a Potent Antimitotic Agent Barinta Widaryanti; Muhammad Da’i; Masashi Kawaichi
Indonesian Journal of Biotechnology Vol 13, No 1 (2008)
Publisher : Universitas Gadjah Mada

Carcinogenesis may resulted from the malfunctioning of programmed cell death. Most of the anticancer drugs incurrent use induce apoptosis in susceptible cells. The fact that disparate agent interacting with different targets seemto induce cell death through some common mechanisms suggest that anticancer activity is determined by the abilityof inhibiting cell growth. Pentagamavunon-1 (PGV-1) is one of the curcumin analogues which showed to havepotency in inhibiting proliferation of T47D human breast carcinoma cells. The effects on T47D cells growth isassociated with cell cycle arrest in G2/M phase at the concentration of 2.5 ?M, followed by hyperploidy. The data onpolymerization assay, indicated that PGV-1 interact with tubulin in different manner from taxol. PGV-1 inhibittubulin polymerization on cell culture while taxol stabilized tubulin polymerization. Immunostainning data onPGV-1 treated cells showed slightly tubulin condensation, while taxol treated cells showed tubulin condensationdistinctly at 12 minutes after releasing from depolymerizing agent.In conclusion, PGV-1 represent a new microtubule inhibitor and has the potential to be developed for antimitoticdrugKey words: Pentagamavunon-1, T47D, tubulin

Characterization of envelope-transmembrane Gene of Jembrana Disease Virus Tabanan 1995 Isolate Asmarani Kusumawati; Rarastoeti Pratiwi; Pudji Astuti; Penny Humaidah Hamid
Indonesian Journal of Biotechnology Vol 15, No 1 (2010)
Publisher : Universitas Gadjah Mada

The availability of specific and rapid detection methods is essential for monitoring the health status of farmed species, particularly in viral disease as in this case early diagnosis is a critical factor in containing disease outbreaks. Jembrana Disease Virus (JDV) is a lentivirus that causes an acute, severe disease syndrome in infected Bali cattle in Indonesia, resulting in heavy economic losses because of the high mortalities. The virus-host interaction and the modes of transmission are still unknown. The goal of the research was to designa probe candidate of Jembrana Disease Virus based on envelope-transmembrane (env-tm) gene to optimize Jembrana disease detection method. The DNA fragment derived from env-tm of JDV was used, cloned in pGEX-TM and expressed in E.coli DH 5α. Sequence analysis was conducted with BLAST programs from NCBI. Sequence analyses of the fragments of env-tm clone, indicated that it has a very closed genetic relation with 97,68% homology identity. Probe was designed based on the conserved region of env-tm using Geneious resulted in JT2 252 bp long. BLAST analyses showed that probes had high specifity to other strains of JDV in Indonesia.Key words : probe, env-tm, JDV, specifity, sensitivity.

Molecular Study on The Pathogenicity of Avian Influenza Virus Haryadi M. Wibowo; Heru Susetya; Tri Untari; Khrisdiana Putri; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.

Combination PT-PCR with in vitro Transcription-Translation System: Rapid and Simple Approach for Monoclonal Antibody Production Muhamad Ali
Indonesian Journal of Biotechnology Vol 14, No 2 (2009)
Publisher : Universitas Gadjah Mada

We have developed a simple and efficient system for screening and generation of monoclonal antibodies, which can bypass conventional monoclonal antibody production system that includes time-consuming, labor-intensive establishment and cultivation. Our method consist of: (1) cDNA synthesis from single B cells of immunized mouse, followed by (ii) PCR amplification of the Lc and Hc (Fd portion) cDNAs separately using low concentration (0,05 ìM) of the respective cDNA-specific primers with 5’ homotags in the presence of the homotag-specific primer (0,5 ìM), (iii) overlapping PCR of the amplified Lc and Hc cDNAs with the cassettes for the T7 promoter (T7P) and T7 terminator (T7T) to construct the following expression units: T7P-Lc-T7T and T7P-Hc-T7T, and (iv) in vitro expression of these units using an Escherichia coli S30 extract followed by ELISA screening without</div><div>purification. Light-and heavy-chain cDNA were amplified and expressed using in vitro system, thus avoiding time consuming steps of cloning and bacterial expression. Having successfully amplified and expressed Lc and Hc genes from single B cells in rapid, simple, versatile, labor-saving, and cost effective, this method seem to be useful</div><div>and applicable for the high-throughput monoclonal antibody generation.

Molecular Genotyping of HBV by using Nested PCR-RFLP among Hepatitis B Patients in Daerah Istimewa Yogyakarta Province and Surrounding Area Aris Haryanto; Nenny Sri Mulyani; Titis Widowati; Nastiti Wijayanti; Purnomo Hadi
Indonesian Journal of Biotechnology Vol 13, No 2 (2008)
Publisher : Universitas Gadjah Mada

Hepatitis B virus (HBV) can be classified into 8 genotypes, genotype A to H. Genotype of HBV is important for clinical and etiological investigations. Research for HBV genotyping, HBV transmission study using nested PCR and HBV genotyping based on RFLP using restriction enzymes have been reported. However, both of those methods have been not applied for HBV genotyping study among hepatitis B patients in endemic area, like Indonesia yet. Molecular genotyping of HBV will describe epidemiology, pathogenesis and clinical implication of HBV. Combination of nested PCR and RFLP (nested PCR-RFLP) method to determine HBV genotype in Indonesia is still less information. The objectives of study were to develop a system for HBV genotyping by nested PCR combined with RFLP (nested PCR-RFLP) method based on nucleotide sequence of surface protein encoding</div><div>gene (S gene) in HBV genome and to confirm HBV genotypes which predominantly found among hepatitis B patients in Daerah Istimewa Yogyakarta Province and surrounding area. Total of 149 sera from chronic hepatitis B patients from Daerah Istimewa Yogyakarta and surrounding areas were collected for in this work. Viral DNA were extracted from sera of hepatitis B patients and used as template for first round nested PCR amplification using outer primers set. Amplicons of first round PCR were used as template for second round amplification using inner primers set. Then, amplicons of second round nested PCR were restriction digested by Sty I and Bsr I enzymes. For HBV genotyping then the restriction products were analyzed by RFLP based on restriction pattern. Results showed that the first round nested PCR amplification generated DNA fragments of whole S gene in length 1.233 bp, and in second round nested PCR amplification using inner primer set generated DNA fragments 585 bp in length. Genotype analysis for all samples using nested PCR-RFLP methods by restriction digested of Sty I and Bsr I enzymes found only 2 HBV genotypes among hepatitis B patients, namely genotype B and C. Quantification</div><div>data showed that most of hepatitis B patients found infected by HBV genotype B (92,8%), genotype C (3,6%) and unidentified genotype (3,6%). Nested PCR-RFLP methods for HBV genotyping is simple and inexpensive for clinical diagnostic in large scale.

Nuclear Import Analysis of Two Different Fluorescent Marker Proteins into Hepatocyte Cell Lines (HuH-7 Cell) Aris Haryanto; Michael Kann
Indonesian Journal of Biotechnology Vol 10, No 2 (2005)
Publisher : Universitas Gadjah Mada

The application of fluorescent proteins as expression markers and protein fusion partners has proved immensely valuable for resolving the organization of biological events in living cells. EGFP and DsRed2 are commonly fluorescent marker protein which is used for biotechnology and cell biology research. The present study was designed to identify the expression vector that suitable to ligate with DNA encoding HBV core protein for intracellular localization study in hepatocyte cell, which were expressed as fusion proteins. We also compared and quantified the expressed fluorescent protein which predominantly localized in the cell compartment. The results indicated that DsRed2 shown as less than ideal for intracellular localization study of than EGFP, because of its tetrameric structure of the fluorescent protein and when fused to a protein of interest, the fusion protein often forms aggregates in the living cells. In contrast, EGFP fluorescent protein shown a much higher proportion of cytoplasmic localization, thus being more suitable for analysis of intracellular localization than DsRed2 fluorescent protein. EGFP fluorescent protein is also capable to produce a strong green fluorescence when excited by blue light, without any exogenously added substrate or cofactor, events inside living cell can thus be visualized in a non-invasive way. Based on our present quantitative data and some reasons above shown that EGFP is more suitable than DsRed2 as a fluorescent marker protein for intracellular localization study into HuH-7 cell.

T47D cells arrested at G2M and Hyperploidy Formation Induced by a Curcumin’s Analogue PGV-1 Muhammad Da’i; Umar Anggara Jenie; Supardjan AM; Masashi Kawaichi; Edy Meiyanto
Indonesian Journal of Biotechnology Vol 12, No 2 (2007)
Publisher : Universitas Gadjah Mada

its chemical structure than curcumin. As a curcumin analogue, PGV-1 was considered to have anticanceractivities. This research was conducted to study the effect of PGV-1 on the cycle progression of T47D cells. Cytotoxiceffects of PGV-1 on T47D cells were determined using MTT assay, and the the effect on cell cycle progressionwas carried out using flowcytometry. Western blot analysis was used to analyze protein expression correspondingto cell cycle progression. The result showed that at the concentration of 2.5 μM PGV-1 inhibited cell cycleprogression through G2/M arrest and induced of cells hyperploidy formation. The hyperploidy formation inducedby PGV-1 was related to the increase of cdc-2 expression. PGV-1 2.5 μM elevated the level of p21 CIP/KIPthrough p53- independent manner. Apoptosis was also induced by PGV-1 at early phase of treatment indicated byPARP cleavage due to activation of caspase-3/7 after 12 h treatment. The results above suggest that PGV-1 inhibitsthe growth of T47D cells targeted on microtubules.Keywords: PGV-1, G2/M arrest, apoptosis, p21

Ethanol Production by Fermentation of Various Sweet-Stalk Sorghum Juices Using Various Yeast Strains Donny Widianto; Akbar Arofatullah; Triwibowo Yuwono; Irfan Dwidya Prijambada
Indonesian Journal of Biotechnology Vol 15, No 2 (2010)
Publisher : Universitas Gadjah Mada

The ethanol production by fermentation of sweet-stalk sorghum juice is affected by the juice composition and the capability of the yeast strain to ferment it. Eight yeast strains were tested on their growth and ethanol fermentation abilities in sweet-stalk sorghum juices extracted from three cultivars of sweet sorghum. The best specific growth rate of the yeast strains grown aerobically in the yeast extract peptone dextrose (YEPD) broth and the sweet-stalk sorghum juices of KCS105, FS501, and FS902 cultivars, were achieved by OUT7903, OUT7913, OUT7903, and OUT7027 yeast strains, respectively. However, the best specific CO2 evolution rate of the yeast strain during fermentation of the juices was achieved by OUT7027 yeast strains. The highest ethanol concentration, ethanol yield, and sugar conversion efficiency (SCE) were obtained by strain OUT7921 when it was employed to ferment sweet-stem sorghum juice of FS902 cultivar. It was also observed that the juice extracted from sweet-stalk sorghum of FS902 cultivar is the most suitable medium for all yeast strains to achieve their best fermentation abilities. Thus, it is likely that the growth and ethanol production ability of a yeast strain in sweet-stalk sorghum juice depend on the physiological responses of the yeasts to nutrientcomposition of the sorghum juice and the sorghum cultivar from which the juice was extracted.Key words : Sweet-stalk sorghum juice, ethanol, fermentation, yeast

Alternative Oxidase (AtAox) c78s Mutant Expression at Escherichia coli (SASX41DB) Ira Djajanegara
Indonesian Journal of Biotechnology Vol 12, No 1 (2007)
Publisher : Universitas Gadjah Mada

Alternative oxidase (AOX) is the terminal oxidase operating in the mitochondrial electron transport chain. Theenzyme is activated by organic acid such as pyruvate and by reduction process. Based on sequences alignment ofalternative oxidase gene (Aox) found in several organisms, there are 2 conserved cysteine residues. In order toinvestigate the importance of those cysteine residues on the activity of AOX, mutation at cysteine residue number 78of Aox gene isolated from Arabidopsis thaliana (AtAox) was conducted. Cysteine at position number 78 was changedinto serine and the c78s mutant was expressed in Escherichia coli strain SASX41DB. This particular E. coli strain isunable to grow aerobically unless transformed with Arabidopsis Aox gene (AtAox). Expression studies on c78smutant showed that this mutant cannot be oxididized and can not be activated by pyruvic acid. This mutant isacivated by succinate instead of pyruvate. Mutation at cysteine closer to the N residue is affecting both organic acidand redox activation. Therefore, it is concluded that cysteine residue closer to the N residue is the site for bothactivation by pyruvate as well as activation by reduction process.Keywords : Alternative oxidase, site-directed mutation, SASx41DB, cysteine residues

Page 34 of 53 | Total Record : 530

32 33 34 35 36

Filter by Year

2005 2026

Filter By Issues

All Issue Vol 31, No 1 (2026) Vol 30, No 4 (2025) Vol 30, No 3 (2025) Vol 30, No 2 (2025) Vol 30, No 1 (2025) Vol 29, No 4 (2024) Vol 29, No 3 (2024) Vol 29, No 2 (2024) Vol 29, No 1 (2024) Vol 28, No 4 (2023) Vol 28, No 3 (2023) Vol 28, No 2 (2023) Vol 28, No 1 (2023) Vol 27, No 4 (2022) Vol 27, No 3 (2022) Vol 27, No 2 (2022) Vol 27, No 1 (2022) Vol 26, No 4 (2021) Vol 26, No 3 (2021) Vol 26, No 2 (2021) Vol 26, No 1 (2021) Vol 25, No 2 (2020) Vol 25, No 1 (2020) Vol 24, No 2 (2019) Vol 24, No 1 (2019) Vol 23, No 2 (2018) Vol 23, No 1 (2018) Vol 22, No 2 (2017) Vol 22, No 1 (2017) Vol 21, No 2 (2016) Vol 21, No 1 (2016) Vol 20, No 2 (2015) Vol 20, No 1 (2015) Vol 19, No 2 (2014) Vol 19, No 1 (2014) Vol 19, No 1 (2014) Vol 18, No 2 (2013) Vol 18, No 2 (2013) Vol 18, No 1 (2013) Vol 18, No 1 (2013) Vol 17, No 2 (2012) Vol 17, No 2 (2012) Vol 17, No 1 (2012) Vol 17, No 1 (2012) Vol 16, No 2 (2011) Vol 16, No 2 (2011) Vol 16, No 1 (2011) Vol 16, No 1 (2011) Vol 15, No 2 (2010) Vol 15, No 2 (2010) Vol 15, No 1 (2010) Vol 15, No 1 (2010) Vol 14, No 2 (2009) Vol 14, No 2 (2009) Vol 14, No 1 (2009) Vol 14, No 1 (2009) Vol 13, No 2 (2008) Vol 13, No 2 (2008) Vol 13, No 1 (2008) Vol 13, No 1 (2008) Vol 12, No 2 (2007) Vol 12, No 2 (2007) Vol 12, No 1 (2007) Vol 12, No 1 (2007) Vol 11, No 2 (2006) Vol 11, No 2 (2006) Vol 11, No 1 (2006) Vol 11, No 1 (2006) Vol 10, No 2 (2005) Vol 10, No 2 (2005) Vol 10, No 1 (2005) Vol 10, No 1 (2005) More Issue

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kab. sleman,

Daerah istimewa yogyakarta

INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Home Page

OAI Link

Editorial Team

Contact

Reviewer

Google Scholar

Contact Name -

Contact Email -

Phone -

Journal Mail Official -

Editorial Address -

Location Kab. sleman, Daerah istimewa yogyakarta INDONESIA

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Contact Name
-

Contact Email
-

Phone
-

Journal Mail Official
-

Editorial Address
-

Location
Kab. sleman,

Daerah istimewa yogyakarta

INDONESIA