Garuda - Garba Rujukan Digital

p-Index From 2021 - 2026

0.562

P-Index

This Author published in this journals

All Journal VALENSI IJFAC (Indonesian Journal of Fundamental and Applied Chemistry) Jurnal Kimia Riset Science and Technology Indonesia Jurnal Penelitian Sains Indonesian Journal of Pure and Applied Chemistry Jurnal Kreativitas PKM Molekul: Jurnal Ilmiah Kimia Jurnal Entomologi Indonesia Majalah Kedokteran Andalas SRIWIJAYA JOURNAL OF ENVIRONMENT BAKTI : Jurnal Pengabdian Kepada Masyarakat

Hermansyah

Department Of Chemistry, Faculty Of Mathematics And Natural Science, Universitas Sriwijaya

Author-ID : 2484287

Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Energy Environmental Science Health Professions Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Nursing Physics Public Health Social Sciences Transportation Other

Published : 22 Documents Claim Missing Document

Claim Missing Document

Articles

1 2 3

Penentuan Tipe Mating Ragi Saccharomyces Cerevisiae Hermansyah Hermansyah
Jurnal Penelitian Sains Vol 13, No 1 (2010)
Publisher : Faculty of Mathtmatics and Natural Sciences

Dalam penelitian genom ragi S. cerevisiae, penentuan tipe mating berguna terutama dalam konstruksi mutan-mutan melalui metode persilangan. Kami menentukan tipe mating sel-sel strain hasil persilangan strain A dan strain B menggunakan strain tester SH682 yang memiliki tipe mating MATa dan strain tester SH683 yang memiliki tipe mating MATα. Hasil menunjukan dari 11 aski dengan 4 spora menghasilkan 2 spora MATα dan 2 spora MATα untuk setiap aski nya. Hal ini mengindikasikan bahwa penentuan tipe mating merupakan salah satu fenotip yang penting dalam teknik tetrad analisis sebagai metode konvensional dalam penelitian molekular ragi

Studi Pemanfaatan Biji Duku (Lansium Domesticum. Jack.) Untuk Obat Diare Secara In Vitro Poedji Loekitowati H; Hermansyah Hermansyah
Jurnal Penelitian Sains No 7 (2000)
Publisher : Faculty of Mathtmatics and Natural Sciences

Telah dilakukan penelitian tentang studi pemanfaatan biji duku (Lansium domesticum. Jack.) untuk obat diare secara in vitro. Mikroba uji yang digunakan adalah bakteri Echerichia coli, Salmonella thypi dan Shigella flexneri. Biji duku diekstraksi dengan etanol selanjutnya di ektraksi cair-cair (ECC) dengan n-heksana, diklorometana, etilasetat dan air, ekstrak dan fraksi yang didapatkan diuji aktivitasnya terhadap bakteri uji. Hasil pengamatan menunjukkan ekstrak etanol, fraksi n-heksana, fraksi diklorometana dan fraksi etilasetat aktif terhadap mikroba penyebab diare secara in vitro. Fraksi diklorometana mempunyai aktivitas paling kuat dengan nilai KMH untuk E.coli 0,3125 mg/ml, S. Flexneri 0,625 mg/ml dan S. Thypi 0,625 mg/ml. Fraksi diklorometana mempunyai nilai kesetaraan dengan antibiotika tetrasiklin anhidrat yang paling baik yaitu 1 mg fraksi diklorometana dan fraksi etilasetat dapat dijadikan bahan baku fitoterapi obat diare dan fraksi diklorometana merupakan fraksi yang paling baik dijadikan bahan baku.

Konstruksi Single Disruptant Penggantian Gen Target dari Ragi Saccharomyces cerevisiae dengan Metode Polymerase Chain Reaction (PCR) Hermansyah Hermansyah
Jurnal Penelitian Sains Vol 12, No 3 (2009)
Publisher : Faculty of Mathtmatics and Natural Sciences

Konstruksi suatu single disruptant merupakan langkah penting dalam mempelajari fungsi suatu gen dari S. cerevisiae. Dalam studi ini kami mengkonstruksi transforman dengan menghilangkan gen PPG1 pengkode protein fosfatase non essential untuk pertumbuhan, tapi terlibat dalam pengendalian akumulasi glikogen dan diduga berperan dalam proses meiosis pada pertumbuhan sel. Konstruksi ppg1_::CgHIS3 single disruptant ini menggunakan metode penggantian gen target (PPG1) dengan suatu marker auksotrop Candida albicans HIS3 yang diamplifikasi menggunakan Polymerase Chain Reaction (PCR) atau disebut PCR mediated disruption. Transforman yang tumbuh di media selektif tanpa histidin dilakukan konfirmasi dengan menggunakan amplifikasi PCR. Hasil elektroforesis gel agarosa 1% menunjukkan bahwa transforman ppg1_::CgHIS3 memiliki pita berukuran 3,3 kb, sedangkan wild type strain memiliki pita berukuran 2,6 kb jika diamplifikasi menggunakan forward primer dan reverse primer yang masing-masing terletak −1000 hingga −979 downstream dan +480 hingga +500 upstream dari urutan PPG1.

Toksisitas Logam Besi (Fe) pada Ikan Air Tawar Herliyanto Herliyanto; Dedik Budianta; Hermansyah Hermansyah
Jurnal Penelitian Sains Vol 17, No 1 (2014)
Publisher : Faculty of Mathtmatics and Natural Sciences

Tujuan dari penelitian ini adalah untuk menentukan konsentrasi logam berat (besi) dalam dua spesies ikan konsumsi yaitu ikan Sepat Siam (Trichogaster pectoralis), ikan Betok (Anabas testudineus), beserta air dan sedimen yang diambil dari air kolam limbah pabrik karet di Kelurahan Keramasan, Kecamatan Kertapati, Palembang yang dilakukan pada bulan Maret sampai Juni, 2013. Logam berat ini dianalisa dengan alat AA-7000 Shimadzu, Spektroskopi Serapan Atom (AAS). Konsentrasi logam berat Fe pada ikan Sepat Siam, ikan Betok , air dan sedimen secara berurutan: (2,70 mg/kg ; 2,63 mg/kg ; 1,78 mg/l dan 9353,1 mg/kg). Hasil anali-sa menunjukan bahwa tingkat akumulasi logam Fe melebihi batas baku mutu yang direkomendasikan oleh BPOM RI untuk ikan atau makanan, sehingga ikan yang ada di dalam kolam tersebut tidak layak untuk dikonsumsi manusia. Konsentrasi logam Fe di permukaan air lebih tinggi dari baku mutu yang direkomendasikan oleh pemerintah provinsi Sumatera Selatan, dan berisiko bagi kesehatan manusia. Dibu-tuhkan pengawasan secara terus-menerus terhadap konsentrasi logam berat dalam air permukaan dan ikan di kolam tersebut. Kata kunci : Besi, Toksisitas

Pengurangan Kadar Amonia dari Limbah Cair Pupuk Urea dengan Proses Adsorpsi menggunakan Adsorben Bentonit Hasbun Kosim; Susila Arita; Hermansyah Hermansyah
Jurnal Penelitian Sains Vol 17, No 2 (2015)
Publisher : Faculty of Mathtmatics and Natural Sciences

The Liquid waste of the urea fertilizer plant was caused by the inefficiency of urea manufacturing process and amonia plant equipment, urea, and packaging section. Inefficiency in equipment was due to that the age of equipment was relatively old, damages in treatment and inaccurate process that resulted ammonia exposed along the river so that it could finally pollute water biota. The research was conducted through adsorption process using bentonite adsorbent which was initially physically activated to open external porosity, so that the ammonia absorption became bigger. The adsorption process was conducted in jar test by using lab scale under the following process and treatment condition: determine the stirring used from 100-200rpm, adsorbent mass 10-40 gram/200 ml, heating temperature 100-1400C. The results of the research showed that the percentage of the highest ammonia concentration reduction in solution waste was 82,05% which was obtained in bentonite activation temperature 1200C, absorbent mass 38 g/200 ml, stirring in 100 rpm and contact time in 60 minutes.

Transcription of Cell Wall Mannoproteins-1 gene in Saccharomyces cerevisiae Mutant Hermansyah Hermansyah
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 4, No. 2, November 2018
Publisher : Syarif Hidayatullah State Islamic University

Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases. The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role. In this research, the disruption of DPPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101). A BamHI - BamHI fragment 3,28 kb DPPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of DPPG1::CgHIS3 in FY833 and did not show 200mg/ml Calco fluor sensitivity, while another mutant DPPG1::CgHIS3 in W303-IA show 100mg/ml congo red sensitivity. Furthermore, to confirm whether DPPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR’s data showed that transcriptional level of CWP1 in DPPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly.

Kinetic and Thermodynamic Study Removal of Co(II) Using Biosorbent Spirulina sp. in Aqueous Solution Risfidian Mohadi; Hermansyah Hermansyah; Poedji Loekitowati Hariani; Zazili Hanafiah; Hilda Zulkifli
IJFAC (Indonesian Journal of Fundamental and Applied Chemistry) Vol 2, No 3 (2017): October 2017
Publisher : IJFAC (Indonesian Journal of Fundamental and Applied Chemistry)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24845/ijfac.v2.i3.83

Kinetic and thermodynamic adsorption study of Co(II) ions from aqueous solutions by dried Spirulina sp. biomass was investigated in the batch system. The Spirulina sp. was isolated and cultured from algae swamp ecosystem in South Sumatera. The adsorption properties of Co(II) onto dried Spirulina sp. biomass was studied by the influence of contact time, initial metal ion concentration and reaction temperature. The experimental results were the rate of adsorption followed the second-order kinetic model with the rate of reaction k2 is 0.023 g mg-1 min-1 and the thermodynamic studies showed that the adsorption was well fitted to the Langmuir’s model, and the amount of Co(II) removed from solution increased with increasing Co(II) concentration with the higher adsorption energy was 10.38 kJ/mol at 30 °C.Keywords: Spirulina sp, Co(II), adsorption, algae swamp, South Sumatera

Assessment of Ogan River Water Quality Kabupaten OKU South Sumatera by NSFWQI Method Eriyana Yulistia; Fauziyah Fauziyah; Hermansyah Hermansyah
IJFAC (Indonesian Journal of Fundamental and Applied Chemistry) Vol 3, No 2 (2018): June 2018
Publisher : IJFAC (Indonesian Journal of Fundamental and Applied Chemistry)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24845/ijfac.v3.i2.54

A Study of physicochemical and microbiology analysis in Ogan River Kabupaten Ogan Komering Ulu was carried out in Mei-Juny 2016. The purpose of this study was to determine the water quality status of Ogan River by using National Sanition Foundation Water Quality Index. Water quality status was studied at six selected stations to represent different localities with varying anthropogenic discharge. Water samples were taken by purposive sampling method. Physicochemical and microbiology parameters of samples were measured pH, temperature, Turbidity, Total Suspended Solids, Dissolved Oxygent, Biochemical Oxygent Demand, Nitrat, Phospate, and Fecal Coliform following standard method. The river water quality status is medium, the value ranged 56-57. Based on these indices it is concluded that the anthropogenic activies along Ogan River effected quality of water Ogan River.

KONSTRUKSI TRIPLE DISRUPTAN GEN PENGKODE PROTEIN FOSFATASE DAN PROTEIN KINASE Saccharomyces cerevisiae Hermansyah Hermansyah; Susilawati Susilawati
Jurnal Kimia Riset Vol. 1 No. 1 (2016): Juni
Publisher : Universitas Airlangga

AbstrakKonstruksi triple disruptan pada Saccharomyces cerevisiae dibuat dengan menyilangkan (crossing) atau melakukan mating antara strain BY4739 (MATa ura3D0 leu2D0 lys2D0 kin3D::KanMX) dengan strain SH6793 (MATa ptp2D::CgHIS3 msg5D::CgLEU2 ura3-52 his3-Δ200 leu2Δ1 lys2Δ202 trp1Δ63). Dari 10 aski yang menghasilkan 40 koloni triple disruptan, hanya 3 koloni yang memiliki fenotip dapat tumbuh di media SC-his, SC-leu, dan YPDA + 100 µg/mL geniticin disulfat. Uji lanjut terhadap tiga koloni tersebut menggunakan amplifikasi PCR dan pemotongan dengan enzim restriksi NruI menghasilkan hanya satu koloni yang memiliki ptp2D. Data ini mengindikasikan bahwa kemungkinan hanya satu koloni yang memiliki triple disruptan ptp2D msg5Dkin3D yaitu koloni 7B. Kata kunci: triple disruptan, Saccharomyces cerevisiae, metode crossing (persilangan) AbstractTriple disruptant were contsructed by crossing or mating between strain BY4739 (MATa ura3D0 leu2D0 lys2D0 kin3D::KanMX) and strain SH6793 (MATa ptp2D::CgHIS3 msg5D::CgLEU2 ura3-52 his3-Δ200 leu2Δ1 lys2Δ202 trp1Δ63). Out of 10 asci generating 40 colonies which have triple disruptant, only 3 colonies showed phenotypics growing on SC-his, SC-leu, and YPDA+ 100 µg/mL geniticine disulfate medium. Further test to these three colonies by using PCR amplication and digesting by restriction enzyme NruI resulted only one colony showing ptp2D. This data indicated that only one colony had ptp2D msg5D kin3D triple disruptant, colony 7B. Keywords: triple disruptant, Saccharomyces cerevisiae, crossing method

Effect of Dilute Acid - Alkaline Pretreatment on Rice Husk Composition and Hydrodynamic Modeling with CFD Novia Novia; Vishnu K Pareek; Hermansyah Hermansyah; Asyeni Miftahul Jannah
Science and Technology Indonesia Vol. 4 No. 1 (2019): January
Publisher : Research Center of Inorganic Materials and Coordination Complexes, FMIPA Universitas Sriwijaya

The high cellulosic content of rice husk can be utilized as a feedstock for pulp and biofuel. Pretreatment is necessary to break the bonds in the complex lignocellulose matrices addressing the cellulose access. This work aims to utilize the rice husk using dilute acid and alkaline pretreatment experimentally and CFD modeling. The study consists of three series of research. The first stage was the dilute acid pretreatment with sulfuric acid concentration of 1% to 5% (v/v) at 85°C for 60 minutes, and alkaline pretreatment with NaOH concentration of 1% to 5% (w/v) at 85oC for 30 minutes separately. The second stage used the combination of both pretreatment. Moreover the last stage of research was hydrodynamic modeling of pretreatment process by CFD (ANSYS FLUENT 16). The experimental results showed that the lowest lignin content after acid pretreatment was about 10.74%. Alkaline pretreatment produced the lowest lignin content of 4.35%. The highest cellulose content was 66.75 % for acid-alkaline pretreatment. The lowest content of lignin was about 6.09% for acid-alkaline pretreatment. The lowest performance of alkaline pretreatment on HWS (hot water solubility) of about 7.34% can be enhanced to 9.71% by using a combination alkaline-acid. The combined pretreatments result hemicellulose of about 9.59% (alkaline-acid) and 9.27% (acid-alkaline). Modeling results showed that the mixing area had the minimum pressure of about -6250 Pa which is vortex leading minimum efficiency of mixing. The rice husk flowed upward to the upper level and mixed with reagent in the perfect mixing.

Co-Authors Addy Rachmat Agung Mataram Ahmad Fatoni Alga Mahida Ali Amran Anita Desiani Anwar, Chairil Asyeni Miftahul Jannah Bambang Suprihatin Carolina Rahman Dedik Budianta Dwirini Retno Gunarti Ella Amalia, Ella Elsa Rama Lumban Gaol Eriyana Yulistia Fauziyah Ferlinahayati Ferlinahayati Hasbun Kosim Herliyanto Herliyanto Hilda Zulkifli Medina Athiah Mega Tiara Putri Meta Mediana Miksusanti Miksusanti Muhammad Azwar Annas Muhammad Irsan Saleh Novia Novia Novia Novia Novian Sutami Novrikasari Novrikasari, Novrikasari Nurlisa Hidayati Poedji Loekitowati H Poedji Loekitowati Hariani Rini Pratiwi Risfidian Mohadi Safyudin Salni Salni Subandrate Subriyer Nasir Sugandi Yahdin Susi Susanti Susila Arita Susilawati Susilawati Vishnu K Pareek Zazili Hanafiah

Title

Found 22 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 22 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 22 Documents
Search