Article Per Year (5 Year)
p-Index From 2021 - 2026
3.623
P-Index
This Author published in this journals
All Journal Jurnal Veteriner AL KAUNIYAH Jurnal Ilmu-Ilmu Pertanian Indonesia JURNAL EKONOMI AKUNTANSI DAN MANAJEMEN Biota JINOP (Jurnal Inovasi Pembelajaran) Jurnal Pendidikan Biologi Indonesia Jurnal Ilmiah Mahasiswa Ekonomi Akuntansi JURNAL IQRA´ JBMP (Jurnal Bisnis, Manajemen dan Perbankan) Jurnal ULTIMA Accounting JURNAL PENDIDIKAN TAMBUSAI ISOQUANT : Jurnal Ekonomi, Manajemen dan Akuntansi EKUITAS (Jurnal Ekonomi dan Keuangan) Akuntansi : Jurnal Akuntansi Integratif Jurnal Aplikasi Dan Inovasi Ipteks SOLIDITAS Jurnal Akademi Akuntansi (JAA) Budimas : Jurnal Pengabdian Masyarakat Proceeding Biology Education Conference Sejahtera: Jurnal Inspirasi Mengabdi Untuk Negeri Jurnal Pengabdian Masyarakat Bangsa Journal of Multiperspectives on Accounting Literature Sasambo: Jurnal Abdimas (Journal of Community Service) JIMEKA
Sri Wahyuni
Universitas Muhammadiyah Malang
Religion Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Energy Engineering Environmental Science Health Professions Industrial & Manufacturing Engineering Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Nursing Physics Public Health Social Sciences Veterinary Other

Published : 30 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 30 Documents
Search

 1   2   3 
PENDAMPINGAN PELAPORAN KEUANGAN PADA KOPERASI BUEKA AS SAKINAH KOTA MALANG Siti Zubaidah; Sri Wibawani Wahyuning Astuti; Dwi Irawan
BUDIMAS : JURNAL PENGABDIAN MASYARAKAT Vol 4, No 2 (2022): BUDIMAS : VOL. 04 NO. 02, 2022
Publisher : LPPM ITB AAS Indonesia Surakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29040/budimas.v4i2.3530

Abstract

Tujuan Pengabdian ini adalah membentuk/mengembangkan sekelompok masyarakat dengan target khusus yang ingin dicapai adalah memberikan pendampingan dalam pelaporan keuangan. Mitra dalam pengabdian ini adalah Koperasi Bueka As-Sakinah yang berada dalam naungan PDA (Pimpinan Daerah Aisyiyah) Kota Malang. Sampai saat ini Mitra merupakan koperasi yang dikelola secara konvensional. Berdasarkan hasil Rapat Anggota Tahunan (RAT) Mitra yang dilaksanakan pada hari Ahad, tanggal 11 Januari 2021 disepakati untuk secara bertahap bermetamorfosa menjadi Koperasi Syariah. Permasalahan yang dihadapi oleh Mitra adalah adanya keterbatasan sumber daya manusia (SDM) untuk menyusun pelaporan keuangan yang terintegrasi dan terkini, sehingga yang terjadi masih menggunakan microsoft excel. Metode yang dipakai dalam menyelesaikan masalah Mitra adalah memberikan pendampingan dan tutorial dalam pelaporan keuangan. Program keuangan accurate digunakan dalam proses pendampingan pelaporan keuangan Syariah
Peningkatan Mutu UKM Melalui Diversifikasi Pengolahan Hasil Bunga Menjadi Produk Minuman Sehat di Kampung Herbal Sukolelo Prigen-Pasuruan Jamroji, Jamroji; Saati, Elfi Anis; Indratmi, Dian; Wachid, Mochammad; Astuti, Sri Wibawani Wahyuning
JURNAL APLIKASI DAN INOVASI IPTEKS "SOLIDITAS" (J-SOLID) Vol 7, No 1 (2024): Jurnal Aplikasi Dan Inovasi Ipteks SOLIDITAS
Publisher : Badan Penerbitan Universitas Widyagama Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31328/js.v7i1.5436

Abstract

Desa Sukolilo berada di wilayah administrasi Kecamatan Prigen, Kabupaten Pasuruan Provinsi Jawa Timur. Keindahan alam wisata Kecamatan Prigen memang sangat menawan, Terlebih Prigen saat ini menjadi daerah wisata pegunungan unggulan di Kabupaten Pasuruan dengan jargon 'Pasuruan City of Mountain”, diantaranya dusun Sukolilo dan Soju (sayuran organik Junggo ) di dusun Junggo Prigen. Tim Pengabdi UMM, melalui kegiatan Penyuluhan Si-Halal dan eduwista, berhasil mendampingi 20 UKM nya memperoleh self declare Sertifikasi halal. Pengabdian ini dilaksanakan guna mendukung program jaminan produk halal UU 33/2014, melalui program UKM naik kelas dan self declare halal bagi para UKM.Produk teknologi termasuk pangan perlu langkah kontinyu hilirisasi bagi masyarakat. UMM sebagai universitas yang mempunyai banyak sumberdaya manusia, mempunyai dosen dengan karya/temuan, keahlian di bidang pengolahan hasil pertanian seperti minuman olahan bunga (bunga mawar, telang, sayuran), yang dapat mensupport pengembangan pariwisata di Prigen tersebut. Produk UKM disana sudah mulai dapat mendukung  kegiatan wisata unggulan disana, diantaranya minuman dari bunga telang, jahe merah, dan lainnya. Masalah yang dihadapi mereka diantaranya mutu produk yang tidak tahan lama, sehinga memerlukan perbaikan daya simpan produk, serta dikenalkan pentingnya diversifikasi oelahan menjadi minuman/herbal, guna mendukung potensi wisata herbal yang potensial di sana. Kegiatan meliputi sosialisasi, pelatihan atau pendampingan antara lain : (i) Sosialiasi terkait Pentingnya mutu produk melalui penggunaan pengawet yang tepat (ii) Pembuatan olahan variasi yang lebih banyak, sebagai produk alternatif UKM pengolah hasil tanaman herbal. Berharap produk unggulan nantinya dapat menjadi icon Kabupaten Pasuruan menambah variasi oleh-oleh wisatawan.            Pelaksanaan pengabdian telah melakukan pendampingan terhadap sekitar 9 UKM berbasis minuman olahan herbal dan atau bebungaan, serta telah dapat membantu meningkatkan pemahaman UKM dalam melakukan pengemasan yang lebih baik agar produk bertahan lebih lama, dan menghasilkan publikasi medsos online: https://pelopornews.co.id/102023/pendampingan-ukm-naik-kelas-melalui-pengolahan-hasil-bunga-menjadi-produk-pangan-sehat-dan-herbal/. UKM hasil kerjsama teh celup mawar plus, telah didampingi LP3H HC UMM melakukan pendafataran Halal.  Hasil pengujian daya antioksidan teh celup mawar plus (dengan 4 daun yaitu daun mangga, mint dan sirsat) yang dihasilkan, mempunyai nilai cukup baik yaitu sekitar 25-77%, dapat dikategorikan minuman tinggi antioksidan.
Investment yield’s affecting factors in equity crowdfunding Astuti, Sri Wibawani Wahyuning; Sudiyono, Widhiyo; Azzahra, Laras
Journal of Multiperspectives on Accounting Literature Vol. 2 No. 2 (2024): Journal of Multiperspectives on Accounting Literature
Publisher : Universitas Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jameela.v2i2.35535

Abstract

Research aims: This research is a quantitative-associative study that aims to analyze the effect of a ratio of company size and NPM on investment yield registered in Santara in 2020. Design/Methodology/Approach: The population in this study is Small and Medium Enterprises (SMEs) registered in Santara and the sample of this study was 40 SMEs with sampling technique using a purposive sampling method. The statistical test in this study uses Multiple Linear Regression and the analysis tool used is SPSS Version 25. Research findings: The results of the test show that (1) company size has no effect on investment yield in SMEs (2) NPM has no effect on investment yield in SMEs. Covid-19 pandemic has made SMEs reluctant to set a Investment Yield that is too high, because it will be dangerous and lead to bankruptcy. Theoretical contribution/Originality:. This study contributes to knowledge of the Equity Crowdfunding Market, how it works. This study also contributes to prove the signal theory in Equity Crowdfunding Market. Practitioner/Policy implication: This research has implications for policy makers to consider determining investment yield based on Size and Net Profit Margin. Research limitation/Implication: The limitation of this study is the minimum of sample. Beside that, this study only focus on one Equity Crowdfunding Platform, so it cannot be generalized to other platforms considering the different policies of each equity crowdfunding platform.
Pendampingan Penyusunan Laporan Corporate Social Responsibility CSR) pada Rayz Hotel Malang Astuti, Sri Wibawani Wahyuning; Zubaidah, Siti; Irawan, Dwi
Jurnal Pengabdian Masyarakat Bangsa Vol. 2 No. 6 (2024): Agustus
Publisher : Amirul Bangun Bangsa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59837/jpmba.v2i6.1216

Abstract

Corporate Social Responsibility (CSR) menurut Global Reporting Initiative (GRI) adalah pendekatan yang mengintegrasikan tanggung jawab sosial, lingkungan, dan ekonomi dalam aktivitas bisnis perusahaan. Laporan CSR yang disusun mengikuti standar GRI berfungsi untuk memastikan transparansi dan akuntabilitas perusahaan terhadap dampak sosial, lingkungan, dan ekonomi. Penelitian ini berfokus pada upaya pendampingan dalam penyusunan laporan CSR bagi Rayz Hotel, sebuah usaha jasa di bidang penginapan dan makanan. Meskipun Rayz Hotel telah mengeluarkan biaya terkait CSR, mereka belum menyusun laporan formal. Metode pengabdian yang diterapkan meliputi perencanaan, pelatihan, pendampingan, dan pelaporan, yang bertujuan untuk membantu Rayz Hotel dalam menyusun laporan CSR sederhana. Hasil dari pengabdian ini termasuk dokumentasi kegiatan CSR seperti pembersihan lingkungan, sertifikasi HACCP, dan pembersihan masjid. Laporan CSR ini diharapkan dapat meningkatkan kepedulian masyarakat terhadap aktivitas perusahaan dan memberikan nilai tambah serta meningkatkan minat stakeholder terhadap kegiatan positif yang dilakukan oleh Rayz Hotel.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Moh. Mirza Nuryady; Elly Purwanti; Siti Nur Aldina; Sri Wahyuni; Tutut Indria Permana; Zakiyatul Khoiriyah; Kiky Martha Ariesaka
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Fleksibilitas Transparansi dan Akuntabilitas dalam Menghindari Penipuan dengan Pendekatan Akuntansi Forensik: Blawi Lamongan Wijaya, Almaira Oktavia; Leniwati, Driana; Wahyuni, Endang Dwi; Astuti, Sri Wibawani Wahyuning; Affan, Muhammad Wildan
Jurnal Ekonomi Akuntansi dan Manajemen Vol. 23 No. 2 (2024)
Publisher : Universitas Jember

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/jeam.v23i2.52377

Abstract

This research aims to find out how a village can flexibly account for its village funds in a transparent manner to minimize acts of fraud by using a forensic accounting approach considering the increasing number of cases related to these acts. Data collection was carried out through in-depth interviews with village officials who were key informants. The method used was snowballing with additional informants. The resulting interview will then be concluded or summarized. Then a triangulation technique was carried out by conducting interviews and checking validity by viewing or observing existing websites so that the data obtained was valid. Based on the results found in the research, it can be concluded that accountability of village funds is needed to minimize this situation, but there are still several factors that make this an opportunity, such as a person's lack of trust in existing temptations and the demands of the people around him who ask him to produce more money. Keywords: Accountability, Forensic Accounting, Flexibility, Fraud
Implementasi PPK Berbasis Kelas Melalui Literasi Pada Masa Pandemi Covid 19 Di SMP Muhammadiyah 1 Malang Sri Wahyuni; Iin Hindun; Yanur Setyaningrum; Masrudi Masrudi
Sasambo: Jurnal Abdimas (Journal of Community Service) Vol. 2 No. 3: October 2020
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/sasambo.v2i3.315

Abstract

SMP Muhammadiyah 01 Malang sudah melaksanakan Program Penguatan Pendidikan Karakter (PPK),berbasis kelas, tetapi dalam pelaksanaannya masih perlu ditingkatkan, karena belum memfokuskan pada variasi literasi dalam pembelajarannya. Salah satu cara untuk meningkatkan penerapan PPK adalah melalui literasi. Pengembangan literasi melalui pendekatan PPK Berbasis Kelas di masa pandemic Covid 19 ini dilakukan melalui pembelajaran Daring. Pengabdian ini bertujuan untuk meningkatkan penerapan PPK dengan gerakan literasi di SMP Muhammadiyah 1 Malang. Pengabdian  dilakukan dengan metode pelatihan dan pendampingan. yang mengacu pada analisis situasi program-program yang telah disepakati bersama. Sasaran pengabdian ini meliputi Kepala Sekolah, 20 guru SMP Muhammadiyah 1 Malang Hasil pengabdian ini adalah guru 80% dapat menganalisis konsep PPK dan mengembangkan RPP yang terintegrasi PPK melalui gerakan literasi, 65% guru dapat melaksanakan pembelajaran menggunakan  RPP yang terintegrasi PPK melalui gerakan literasi secara daring. Kesimpulan kegiatan pengabdian ini adalah meningkatnya wawasan dan kompetensi guru dalam menyusun RPP berbasis PPK melalui gerakan literasi, meningkatnya ketrampilan guru dalam melaksanakan pembelajaran di kelas sesuai Kurikulum 2013 yang menerapkan PPK melalui gerakan literasi lebih bervariasi meliputi literasi baca tulis, literasi numerik, literasi science, literasi ICT dan literasi budaya.
PENGARUH EKSTRAK DAUN SERAI (Cymbopogon citratus (DC.) Stapf) TERHADAP PERKEMBANGBIAKAN KUTU BERAS (Sitophilus oryzae L.) Miftachur Rohma; Moh Mirza Nuryady; Sri Wahyuni
Jurnal Ilmu-Ilmu Pertanian Indonesia Vol 23 No 2 (2021)
Publisher : BPFP Universitas Bengkulu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31186/jipi.23.2.136-145

Abstract

[THE EFFECT OF LEMONGRASS (Cymbopogon citratus (DC.) Stapf) LEAVES EXTRACT ON RICE WEEVIL (Sitophilus oryzae L.) REPRODUCTION]. Rice weevil (Sitophilus oryzae) is the most destructive pest of rice. S. oryzae can be controlled with lemongrass (Cymbopogon citratus). C. citratus leaves extract can be used as pests control because it contains potential active compounds. This study aims to determine the effect of the several concentrations of C. citratus extract from fresh and dry leaves on S. oryzae reproduction. This study was used factorial RAL with two factors. The first factor was concentrations which were divided into 5%, 10%, 20%, as well as the positive control group (alfamethrin 1%) and the negative control group (aqua dest). The second factor was the use of C. citratus leaves which were divided into fresh and dry leaves. Parameters observed were the repellent of S. oryzae, the number of new adults, the damaged rice percentage, and the rice organoleptic. The rice organoleptic was conducted to observe color, texture, smell, and taste. The data were analyzed using a two-way ANOVA test. The best result has been found in the concentration of 20% from fresh C. citratus treatment with an average repellency of 68.50±14.45%, the number of new adults of 29±4.99, and the damaged rice percentage of 24.75±4.113%. The result of the organoleptic test with the highest average value was found in the concentration 5% from fresh C. citratus treatment. The results of the organoleptic test with Kruskal-Wallis showed that there were no significant differences in the color, texture, smell, and taste of rice. The conclusion of this study showed that C. citratus can be used effectively against S. oryzae.
Analysis of Environmental, Social and Corporate Governance Impact of Carnival Activities on Village Sustainability Adi Maulana, Bimo; Driana Leniwati; Sri Wibawani Wahyuning Astuti
Akuntansi: Jurnal Akuntansi Integratif Vol. 10 No. 1 (2024): Volume 10 Nomor 1 April 2024
Publisher : Prodi Akuntansi UIN Sunan Ampel Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29080/jai.v10i1.1555

Abstract

This research aims to find out whether the ESG concept can only be used in a company or can also be used to analyze an activity, where this activity can have an impact on society. By using an interpretive paradigm, this researcher tries to interpret the impact that occurs on carnival activities in terms of the ESG concept. Data was obtained using in-depth interviews with the organizing committee, activity participants and also local businesses involved in the activity who were key informants. The method used is a snowballing system where interview results are grouped and data reduction is carried out before being analyzed and conclusions drawn or verified. Triangulation was also carried out using different question techniques asked to ensure the validity of the data to key informants. By using triangulation techniques, researchers ensure that the data obtained is valid. The results of this research found that there are many impacts that occur in carnival activities which are reviewed with the ESG concept which can later be used as something for the sustainability of the village and can also be a reason in making decisions for the sustainability of the village and also for the sustainability of this activity. In other cases The impact resulting from the concept that has been applied to this activity can be seen from the environmental, social and environmental impacts of this activity also governance.
ANALISIS KINERJA KEUANGAN PAJAK DAERAH MENGGUNAKAN METODE VALUE FOR MONEY Putri, Cyntia Johannes; Wahyuning Astuti, Sri WIbawani
Jurnal Ilmiah Mahasiswa Ekonomi Akuntansi Vol 6, No 2 (2021): Mei 2021
Publisher : Accounting Departement Economics and Business Faculty Syiah Kuala University

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This study aims to determine how the level of economy, effectiveness, and efficiency of local tax financial performance in Ponorogo Regency. The object of this research is Ponorogo Regency. This research uses a descriptive method. Data collection techniques through documentation which can be done by re-recording, photographing, photocopying or buying. The type of data used is in the form of government published financial reports, namely local tax revenue reports and Ponorogo Regency regional income budget data. The results showed that the financial performance of local taxes measured using economic ratios was in the economic category, the efficiency ratio was in the very efficient category. The results of the effectiveness ratio show that the financial performance of local taxes is very effective.
Co-Authors Adi Maulana, Bimo Ahmad Juanda Ainur Rofieq Alfreda Divia Rachma Arlita Ariyani Puspitasari Atok Miftachul Hudha Aviani Widyastuti Azzahra, Laras Cantia Putri Chasan Bisri Cyntia Johannes Putri Dance Bobia Mesah Diani Fatmawati Driana Leniwati Dwi Irawan Eko Susetyarini Eko Susetyarini Elfi Anis Saati Elly Purwanti Endang Dwi Wahyuni Firda Ayu Amalia Firdiani Yuliana Fuad Jaya Miharja Husamah Husamah Iin Hindun Jamroji Jamroji Kiky Martha Ariesaka Kurnia Ayu Miranti Lika Dwi Apriani Masrudi Masrudi Miftachur Rohma Moch. Agus Krisno Budiyanto Mochammad Wachid Moh Miftachul Fadhli Moh. Mirza Nuryady Moh. Syaifuddin Qomar MP Editor, Ir. Dian Indratmi, MP Muhammad Wildan Affan Nur Afifah Nurfadilah Yusri Putri, Cyntia Johannes Ribut Wahyu Eryanti Roimil Latifa Roimil Latifa Roro Eko Susetyarini Roro Eko Susetyorini Rr. Eko Susetyarini Siti Nur Aldina Siti Zubaidah Siti Zubaidah Sudiyono, Widhiyo Sukarsono Sukarsono Triani Liliek Tutut Indria Permana Ulul Shintia Rabumi Umigati Umigati Wahyu Prihanta Wijaya, Almaira Oktavia Yanur Setyaningrum Yuni Pantiwati Yurike Fransischa Trisnaningrum Zakiyatul Khoiriyah