Claim Missing Document
Check
Articles

Found 23 Documents
Search

EFFECT OF POMELO (CITRUS GRANDIS) ETHANOLIC EXTRACT ON ATHEROSCLEROTIC PLAQUE FORMATION Mudzakkir Taufiqurrahman; Kiky Martha Ariesaka; Hilda Khairinnisa; Wahyu Dian Puspita; Azka Darajat; Al Munawir
UNEJ e-Proceeding 2016: Proceeding The 1st International Basic Science Conference
Publisher : UPT Penerbitan Universitas Jember

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Cardiovascular disease is a major health problem in developed and developing countries and still be the first rank causing death in the world, including Indonesia. Most of cardiovascular disease caused by atherosclerosis. Macrophage apoptosis can reduce the size of atherogenic lesions and the progression of atherosclerotic plaque formation. Proapopstosis effects on macrophages owned by flavonoids. This study aims to know the potential of flavonoids found in Citrus grandis extract which works by suppressing the phosphorylation of AKT Ser473 so that the formation of foam cells (foam call) can be minimized. The research sample is 38 male Wistar rats weighing 90-150 grams. Samples were divided into 5 groups. All groups except normal control group were induced atherosclerosis by utilizing the shear stress mechanism at the branch of the abdominal aorta. Shear stress created by injecting adrenaline i.v. followed by hyperlipidemic diet (egg yolk) for 3 weeks. Then, during the next two weeks, the positive control group treated with simvastatin, while the treatment group were treated with extracts of C. grandis (ECG) known to contains flavonoids. Macroscopic showed that ECG could reduce atherosclerotic lesions. of citrus grandis. The sample data captured in the form of mouse blood and abdominal aortic tissues. Based on the results of the TLC screening, Ethanolic Extrxct Meanwhile, the group given simvastatin as a positive control also showed fewer atherosclerotic lesions. ECG proven to lower cholesterol and triglyceride levels of rats that had been induced atherosclerosis. Award ECG doses of 500 and 1000 mg/kg showed a significant decrease in cholesterol (p <0.01) compared to the negative control group. ECG is proven to reduce atherosclerotic lesions, so that ECG can be used as an adjuvant for simvastatin to achieve maximal therapeutic effect against atherosclerosis.
Immunostimulant Effect of Garlic Chives Leaf Ethanolic Extract (Allium tuberosum) by Increasing Level of Antioxidant at Rats Doxorubicin-Induced Rats Ika Rahmawati Sutejo; Kiky Martha Ariesaka; Fuad Adi Prasetyo; Mudzakkir Taufiqurrqhman; Ain Yuanita Insani; Brilliant Givya Ariansari
Indonesian Journal of Cancer Chemoprevention Vol 7, No 3 (2016)
Publisher : Indonesian Society for Cancer Chemoprevention

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14499/indonesianjcanchemoprev7iss3pp93-98

Abstract

Cancer is one of the leading causes of death in the world, approximately 14 million new cases and 8.2 million deaths each year. Doxorubicin is a well-known chemotherapy drug which frequently used in treating various types of cancer. However,  doxorubicin posesses several side effects including cardiotoxic, hepatotoxic, nephrotoxic, and immunosuppression. One of the natural product that can be used as an adjuvant of doxorubicin to reduce the toxic effects is garlic chives (Allium tuberosum). The purpose of this study was to determine the effect of Allium tuberosum based on hematological profile, levels of CD4+, CD8+, and MDA serum of male Wistar rats which induced by doxorubicin. The hematological profile was analyzes by blood smear, levels of CD4+ and CD8+ were conducted by flowcytometry and levels of MDA serum were determined by spectrofotometry. The results showed that the etanolic extract of Allium tuberosum (EAT) increased neutrophil and lymphocyte, percentage of CD4+ cells (p<0.01) and CD8+ cells. It also decreased the levels of serum MDA (p<0.01). These results indicated that EAT work as immunostimulant possibly through an antioxidant mechanism (MDA). It can be concluded that EAT can be developed as adjuvant for doxorubicin.Keywords: doxorubicin, Allium tuberosum, immunostimulant, antioxidant, CD4+, CD8+ 
Pendampingan Pengelolaan Laboratorium IPA SMP Muhammadiyah Kota Malang Untuk Memfasilitasi Keterampilan Proses Sains Siswa Permana, Tutut Indria; Nuryady, Moh Mirza; Ariesaka, Kiky Martha; Ganes, Tegar; Nazila, Farah
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 9 No. 2 (2024): June
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/linov.v9i2.1855

Abstract

Pengelolaan laboratorium IPA harus didayagunakan secara efektif dan efisien untuk mendukung kegiatan kurikuler secara optimal. Pengelolaan laboratorium IPA yang optimal dapat mendukung tercapainya keterampilan proses sains siswa ketika menggunakan laboratorium pada proses pembelajaran. Namun demikian, tidak semua sekolah sudah memiliki sumber daya yang memadai dan pengelolaan laboratorium IPA yang baik. Seperti halnya yang terjadi di beberapa SMP Muhammadiyah di kota Malang yang mengalami kendala dalam pengelolaan laboratorium IPA di sekolah, seperti belum adanya etiket dan label pada alat bahan, belum adanya Standart Operational Procedure setiap alat, dan juga penataan alat bahan yang tidak aturan. Agar mampu memfasilitasi siswa untuk dapat memiliki keterampilan proses sains, sekolah memang perlu melakukan pengelolaan laboratorium IPA secara optimal untuk mendukung kegiatan akademik maupun non akademik siswa. Pengelolaan laboratorium yang baik akan memudahkan proses pembelajaran laboratorium, sehingga kegiatan pembelajaran praktik dilaboratorium dapat lebih maksimal. Kegiatan pengabdian kepada masyarakat ini bertujuan untuk memberikan pendampingan dalam pengelolaan laboratorium IPA di SMP Muhammadiyah kota Malang. Kegiatan pengelolaan laboratorium ditujukan pada pihak sekolah yang terdiri dari pejabat struktural dan guru mata pelajaran yang berkaitan dengan kegiatan praktikum dalam laboratorium IPA. Kegiatan pengabdian tersusun atas: 1) observasi kondisi laboratorium IPA yang ada di sekolah; 2) sosialisasi dan workshop tentang standar pengelolaan laboratoium IPA; dan 3) pelaksanaan perbaikan managemen pengelolaan laboratorium IPA. Hasil kegiatan pengabdian ini adalah adanya peningkatan pengetahuan guru dalam pengelolaan laboratorium yang sesuai standar dan telah dilakukan perbaikan managemen pengelolaan laboratorium dengan melengkapi SOP yang ada di laboratorium. Lebih lanjut lagi, di laboratorium setiap sekolah mitra telah terdapat poster tatacara praktikum, SOP, etiket dan labelling alat bahan. Dengan demikian kegiatan pengabdian ini akan mewujudkan pengelolaan laboratorium IPA yang memadai untuk mendukung kegiatan akademik dan non akademik siswa yang bertujuan untuk meningkatkan kualitas proses pembelajaran di SMP Muhammadiyah Malang. Assistance in Managing Science Laboratories at Muhammadiyah Junior High Schools in Malang City to Facilitate Students' Scientific Process Skills Abstract The management of science laboratories must be utilized effectively and efficiently to optimally support curricular activities. Optimal management of science laboratories can support the achievement of students' scientific process skills when using the laboratory in the learning process. However, not all schools have adequate resources and good science laboratory management. This is the case in several Muhammadiyah Junior High Schools in Malang city, which face challenges in managing their science laboratories, such as the lack of labels and etiquette on equipment and materials, the absence of Standard Operating Procedures for each piece of equipment, and the disorganized arrangement of equipment and materials. To facilitate students in acquiring scientific process skills, schools indeed need to manage their science laboratories optimally to support both academic and non-academic student activities. Good laboratory management will facilitate the laboratory learning process, making practical learning activities in the laboratory more effective. This community service activity aims to provide assistance in managing science laboratories at Muhammadiyah Junior High Schools in Malang city. The laboratory management activities are aimed at school personnel, including structural officials and subject teachers involved in laboratory practical activities. The community service activities consist of: 1) observing the current condition of science laboratories in the schools; 2) socialization and workshops on standard science laboratory management; and 3) implementing improvements in laboratory management. The results of this community service activity include an increase in teachers' knowledge in managing laboratories according to standards, and improvements in laboratory management by completing the existing SOPs in the laboratories. Furthermore, each partner school's laboratory now has posters on practical procedures, SOPs, etiquette, and labeling of equipment and materials. Thus, this community service activity will result in adequate science laboratory management to support both academic and non-academic student activities, aiming to improve the quality of the learning process at Muhammadiyah Junior High Schools in Malang city.
Pengukuran Tingkat Kebugaran dan Skrining Kesehatan Atlet Akademi Sepak Bola di Kota Malang Ariesaka, Kiky Martha; Fanani, Erianto; Sishartami, Lintang Widya; Wahyudi, Nanang Tri; Fulviansyah, Zaidhan Lucano; Gelaner, Nauval Akhmadian; Haryono, Putri Dwinita; Suhartanti, Ajeng Sri
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 9 No. 3 (2024): September
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/linov.v9i3.2070

Abstract

Pendidikan olahraga pada usia dini sangat penting dalam menciptakan kualitas atlet yang baik. Aji Santoso International Football Academy (ASIFA) adalah akademi sepak bola internasional yang berorientasi pada prestasi unggul melalui pendidikan olahraga yang baik. Namun, proses seleksi di ASIFA lebih menitikberatkan pada postur dan kemampuan teknis pemain. Tujuan kegiatan ini adalah untuk melakukan skrining kesehatan komprehensif pada siswa ASIFA guna memberikan gambaran lengkap mengenai kondisi kesehatan dan kebugaran mereka serta memberikan rekomendasi intervensi kesehatan yang diperlukan. Skrining kesehatan dilakukan pada total 72 siswa ASIFA. Skrining ini meliputi pengukuran tekanan darah dan laju nadi menggunakan sphygmomanometer digital, tinggi badan menggunakan stature meter, berat badan, persen lemak, body age, BMI, kebutuhan kalori, dan lemak visceral menggunakan body composition analyzer, serta antropometri lain dari lingkar tubuh menggunakan pita ukur. Pendekatan PDCA (Plan-Do-Check-Act) digunakan untuk memastikan pendekatan yang sistematis dalam skrining dan intervensi kesehatan. Hasil penelitian menunjukkan bahwa usia rata-rata siswa adalah 15,71 tahun dengan mayoritas berada dalam rentang usia 14-17 tahun (63,9%). Berat badan rata-rata siswa adalah 55,51 kg dan tinggi badan rata-rata 163,46 cm. Berdasarkan Indeks Massa Tubuh (IMT), mayoritas siswa berada dalam kategori normal (68,1%), sementara 25% siswa masuk dalam kategori underweight dan 6,9% siswa berada dalam kategori overweight. Kondisi underweight pada 25% siswa menunjukkan adanya potensi masalah nutrisi yang perlu segera ditangani untuk memastikan kebugaran dan performa optimal. Intervensi kesehatan diperlukan untuk meningkatkan performa atlet muda. Fitness Level Measurement and Health Screening of Football Academy Athletes in Malang City Abstract Early-age sports education is crucial in creating high-quality athletes. Aji Santoso International Football Academy (ASIFA) is an international soccer academy focused on achieving excellence through quality sports education. However, the selection process at ASIFA emphasizes players' posture and technical skills. The aim of this activity is to conduct comprehensive health screenings on ASIFA students to provide a complete overview of their health and fitness conditions and to provide necessary health intervention recommendations. Health screenings were conducted on a total of 72 ASIFA students. These screenings included measuring blood pressure and pulse rate using a digital sphygmomanometer, height using a stature meter, weight, body fat percentage, body age, BMI, caloric needs, and visceral fat using a body composition analyzer, as well as other anthropometric measurements of body circumference using a measuring tape. The PDCA (Plan-Do-Check-Act) approach was used to ensure a systematic approach to health screening and intervention. The results showed that the average age of the students was 15.71 years, with the majority being in the age range of 14-17 years (63.9%). The average weight of the students was 55.51 kg and the average height was 163.46 cm. Based on the Body Mass Index (BMI), the majority of students were in the normal category (68.1%), while 25% of students were underweight and 6.9% of students were overweight. The underweight condition of 25% of the students indicates potential nutritional problems that need to be addressed immediately to ensure optimal fitness and performance. Health interventions are necessary to improve the performance of young athletes.
In Silico Analysis of Active Compounds from Allium tuberosum as Drug Candidate for Inhibitor DENV-3 Envelope Protein Nuryady, Moh Mirza; Juliana, Levina Imelda; Ariesaka, Kiky Martha
Jurnal ILMU DASAR Vol 25 No 2 (2024)
Publisher : Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Jember

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/jid.v25i2.36400

Abstract

Dengue fever has become a global health issue, the development of dengue vaccine has not yet been established. Medicinal plants are an ideal alternative for DENV infection drugs. The purpose of this study was to determine in silico the potential of active compounds from Allium tuberosum as envelope protein inhibitors of DENV-3. The method of this research is to do docking analysis of compounds with DENV-3 envelope protein and analysis of amino acid residues using MVD, pharmacokinetic analysis using SwissADME, toxicity analysis using ProTox-II. The best docking value for the potential activity to inhibit the receptor DENV-3 is the thymidine compound (RS: -81.1245 kcal/mol). The highest activity of thymidine is the most promising as a drug candidate, as evidenced by the toxicity analysis which is predicted to have non-carcinogenic, non-mutagenic, inactive properties against hepatotoxicity, cytotoxicity and immunotoxicity parameters, as well as pharmacokinetic analysis that fulfills 6 parameters of lipopolicity, molecular weight, polarity. , insolubility, insaturation, and flexibility which indicate the drug candidate of thymidine is safe for its bioavailability. The conclusion from the results of this study is that one compound has the ability as an antiviral, binding score with DENV-3 is good, and is safe in terms of pharmacokinetics and toxicity, namely thymidine compound.
Toxicity profile of jamu sari rapet albumin and creatinine levels in female rats (Rattus norvegicus) Ulfa, Darlah Immaria; Nuryady, Moh. Mirza; Wahyuni, Sri; Susetyarini, Rr Eko; Purwanti, Elly; Ariesaka, Kiky Martha; Fatmawati, Diani
Jurnal Biolokus : Jurnal Penelitian Pendidikan Biologi dan Biologi Vol 6, No 2 (2023): December
Publisher : Universitas Islam Negeri Sumatera Utara

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30821/biolokus.v6i2.3119

Abstract

Married Madurese women routinely consume jamu sari rapet to please their husbands. There is no information on the toxicity test of jamu sari rapet.  The kidney is one of the organs that is targeted by toxic substances that enter the body. One of the parameters controlled is albumin and creatinine. The purpose of this study was to determine the effect on albumin and creatinine levels in white rats (Rattus norvegicus) given jamu sari rapet. This type of research is true experimental with a quantitative approach. This study was conducted for 28 days (subchronic). Data were analyzed using the Kruskal Wallis test. There were 4 groups, namely dose group 1 (1,56 g/gBB), dose group 2 (1,60 g/gBB), dose group 3 (1,66 g/gBB) and the control group. The results of this study showed no significant difference between albumin and creatinine levels compared to the control group. The conclusion shows that jamu sari rapet given to female rats (Rattus norvegicus) for 28 days has no significant effect on albumin and creatinine levels.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Moh. Mirza Nuryady; Elly Purwanti; Siti Nur Aldina; Sri Wahyuni; Tutut Indria Permana; Zakiyatul Khoiriyah; Kiky Martha Ariesaka
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Expression of gonadotropin-releasing hormone receptor type-II correlates with proliferation activity in tissue microarray of rare ovarian tumor Ariesaka, Kiky Martha; Kusumanto, Ardhanu; Zucha, Muhammad Ary; Anggorowati, Nungki; Wicaksono, Agil Wahyu; Yunus, Moch; Fanani, Erianto; Nuryady, Moh Mirza
JURNAL INDONESIA DARI ILMU LABORATORIUM MEDIS DAN TEKNOLOGI Vol 6 No 2 (2024): Promising and Valuable Research Towards Diagnosis, Prognosis and Treatment of Dis
Publisher : Universitas Nahdlatul Ulama Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33086/ijmlst.v6i2.6034

Abstract

Activation of Gonadotropin-Releasing Hormone type II Receptors (GnRHR-II) exhibits antiproliferative activity. GnRHR-II is not only expressed exclusively in the pituitary, but also in a variety of tumors. To date, the clinical relevance of GnRHR-II in ovarian tumors is unclear. In addition, there is a lack of literature addressing GnRHR-II in ovarian tumors, especially rare types. This study was conducted to investigare the correlation between GnRHR-II expression with clinicopathology and proliferative activity of rare ovarian tumors. The purpose of this study was an analytic observational study with a cross-sectional design that utilized 18 ovarian tumor samples on tissue microarray (TMA). The expression of GnRHR-II and Ki67 was assessed using immunohistochemical staining (IHC) and observed using the IHC profiler plugin ImageJ software to obtain their respective H-scores. The data was analyzed using independent t-test, ANOVA, Pearson's test, and Fisher's exact test based on data types. The value of p<0.05 was considered statistically significant. GnRHR-II is expressed in various forms in ovarian tumors, including extrapituitary expression. GnRHR-II expression was highest in the sex cord stromal tumor (SCST) group, 110.30 ± 23.89 (p<0.0001). In addition, there was also a significant difference between GnRHR-II expression with age (p<0.001) and the primary tumor (p<0.05), but not with tumor type (p=0.101). There is a correlation between GnRHR-II expression and proliferative activity (r=-0.043, p=0.866). Elevated GnRHR-II expression is significantly correlation with SCST, individuals over 40 years of age, and tumors confined to the ovary and it is correlates with lower proliferative activity, although this correlation is very weak.
Enhancement of Teachers' Knowledge in Gamification for Improving Reading Skills in Students with Autism Spectrum Disorder Kurniawan, Agung; Ariesaka, Kiky Martha; Fukata, Editya; Wijaya, Andreas Budi; Putri, Angelica Igsanti; Prasetya, Ahmada Viosepta; Devi, Athaayaa Nastiti Ulayya
Jurnal ORTOPEDAGOGIA Vol 10, No 2 (2024): November
Publisher : Universitas Negeri Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17977/um031v10i22024p75-82

Abstract

Autism Spectrum Disorder (ASD) is a developmental disorder characterized by challenges with social interaction, communication, and repetitive behaviors. Students with ASD often struggle with reading skills due to deficits in language comprehension, attention, and social communication. Gamification, applying game-design elements in non-game contexts, has emerged as a promising approach to enhance learning for these students. This study aimed to develop and implement a gamification-based learning application to improve the reading skills of students with ASD in special schools. The initiative sought to empower teachers through comprehensive training and support, enabling them to effectively use gamified educational tools. The method followed the ADDIE model: Analysis involved a needs assessment; Design included creating a training program and evaluation instruments; Development involved creating training materials and preparing for pilot testing; Implementation included conducting the training for teacher and administering pre-tests and post-tests; Evaluation consisted of analyzing test data and feedback. The training session was conducted on July 17, 2024, at SLB Autis Lab UM. Paired t-test results showed a significant increase in mean scores from pre-test (78.67±11.87) to post-test (88.00±10.14), with a P-value of 0.014, indicating effective training. Participant feedback highlighted the gamification application’s appealing interface, ease of use, and positive impact on student motivation, participation, and reading skills. The gamification-based learning application effectively improves reading skills in students with ASD and enhances teachers’ knowledge and skills in using such tools. Ongoing support and professional development for educators are crucial for integrating innovative tools into teaching practices, fostering academic success and overall development for students with ASD.
IN SILICO AND IN VITRO ANALYSIS OF BLASHV AND BLATEM GENE PRIMERS Khoiro, Aisha Azaria Nisa’ul; Purwanti, Elly; Miharja, Fuad Jaya; Ariesaka, Kiky Martha; Nuryady, Moh. Mirza
BIOLINK (Jurnal Biologi Lingkungan Industri Kesehatan) Vol. 11 No. 2 (2025): Biolink February
Publisher : Universitas Medan Area

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31289/biolink.v11i2.13830

Abstract

Bacterial pollution that occurs in the environment causes an increase in disease and antibiotic use, which leads to resistance. This study analyzes antibiotic-resistant blaSHV and blaTEM genes in silico and in vitro. Antibiotic-resistant bacterial isolates on ESBL will be carried out PCR and electrophoresis. The type of research used is descriptive observational research conducted from April to September 2024. The sampling technique used was random sampling. Primer blaSHV with sequence F' AGGATTGACTGCCTTTTTG and R' ATTTGCTGATTTCGCTCG, while primer blaTEM has sequence F' ATCAGCAATAAACCAGC and R' CCCCGAAGAACGTTTTC. Data analysis was carried out by analyzing in silico results obtained from the NCBI website and observing the visualization results of PCR amplification indicated by the presence of DNA bands.  In silico results showed 25 organisms attached to blaSHV and 29 organisms to blaTEM. In vitro results shown by electrophoresis visualization showed blaSHV amplicons measuring 392 bp with an annealing temperature of 50.5°C, and blaTEM measuring 517 bp with an annealing temperature of 42°C. The success rate of PCR was shown by clear and specific amplification of both genes, indicating that the PCR method performed was effective in detecting blaSHV and blaTEM genes in ESBL antibiotic-resistant bacterial isolate samples.  
Co-Authors Agil Wahyu Wicaksono Agung Kurniawan Ain Yuanita Insani Ain Yuanita Insani Al Munawir Aldina, Siti Nur Anditri Weningtyas Andreas Budi Wijaya Ardhanu Kusumanto Arif Ladika Aulia, Sabrina Auliarahama, Zhafirah Auliarahma, Zhafirah Azka Darajat Bakhtiar, Fannia Yosa Brilliant Givya Ariansari Brilliant Givya Ariansari Devi, Athaayaa Nastiti Ulayya Diani Fatmawati Editya Fukata Elly Purwanti Erfan Efendi Fanani, Erianto Fannia Yosa Bakhtiar Faridatus Solikha Fatmawati, Diani Fuad Adi Prasetyo Fuad Adi Prasetyo Fuad Jaya Miharja Fulviansyah, Zaidhan Lucano Ganes, Tegar Gelaner, Nauval Akhmadian Haryono, Putri Dwinita Hilda Khairinnisa Hilma Tsurayya Iftitahurroza Iftitahurroza, Hilma Tsurayya Ika Agus Rini, Ika Agus Ika Rahmawati Sutejo Ika Wahyuni Inggita Utami Ismaya, Matius Dimas Reza Dana Janufian, Fairus Athar Juliana, Imelda Juliana, Levina Imelda Khodijah Khodijah Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul KURNIAWATI, ANDINI Levina Levina, Levina Lintang Widya Sishartami Lintang Widya Sishartami Maliza, Rita Manggolono, Lintang Nirmalasari Gemalochaya Mochammad Yunus, Mochammad Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Mudzakir Taufiqurrahman Mudzakkir Taufiqurrahman Mudzakkir Taufiqurrqhman Nanang Tri Wahyudi Nazila, Farah Nungki Anggorowati Prasetya, Ahmada Viosepta Prayogi, Fahrizal Ryuzen Purwanti, Elly Putra, Alvino Ramadhany Putri, Adhiena Liany Anastasia Putri, Angelica Igsanti Qurrataa'ayun, Ahmad Al Qurrataa'yun, Ahmad Al Siti Nur Aldina Sri Wahyuni Sri Wahyuni Suhartanti, Ajeng Sri Susetyarini, Rr Eko Tsaqif, Anindya Zerlina Tutut Indria Permana Ulfa, Darlah Immaria Wahyu Dian Puspita Wahyuni, Sri Wibisono, Taurisma Aulia Nanda Widya Sishartami, Lintang Wiratama, Arif Ladika Zakiyatul Khoiriyah Zucha, Muhammad Ary