cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Chemistry
ISSN : 14119420     EISSN : 24601578     DOI : -
Indonesian Journal of Chemistry is an International, peer-reviewed, open access journal that publishes original research articles, review articles, as well as short communication in all areas of chemistry including applied chemistry. The journal is accredited by The Ministry of Research, Technology and Higher Education (RISTEKDIKTI) No : 21/E/KPT/2018 (in First Rank) and indexed in Scopus since 2012. Since 2018 (Volume 18), Indonesian Journal of Chemistry publish four issues (numbers) annually (February, May, August and November).
Arjuna Subject : -
Articles 25 Documents
Search results for , issue "Vol 21, No 4 (2021)" : 25 Documents clear
Hydrochloric Acid and/or Sodium Hydroxide-modified Zeolite Y for Catalytic Hydrotreating of α-Cellulose Bio-Oil Jason Mandela; Wega Trisunaryanti; Triyono Triyono; Mamoru Koketsu; Dyah Ayu Fatmawati
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.55645

Abstract

The zeolite Y had been successfully modified by HCl and/or NaOH treatment. The modification of zeolite Y was performed by leaching the protonated zeolite Y (HY) in HCl solution (0.1 and 0.5 M) at 70 °C for 3 h resulting in DY0.1 and DY0.5. Subsequently, HY, DY0.1, and DY0.5 zeolites were immersed in 0.1 M NaOH for 15 min at room temperature resulting in AHY, ADY0.1, and ADY0.5. All samples were analyzed for acidity, crystallinity, Si/Al ratio, morphology, and textural properties. The catalytic performance of all samples was investigated in hydrotreating of α-cellulose bio-oil with a catalyst/feed weight ratio of 1/30. The HCl and NaOH treatment led to the decrease of the zeolite Y crystallinity and the increase of the zeolite Y average pore diameter (i.e., the mesopore distribution). The ADY0.5 gave the highest mesopore distribution, which was 43.7%, with an average pore diameter of 4.59 nm. Moreover, both of the treatments were found to increase the Si/Al ratio that caused the decrease of zeolites Y acidity. All the zeolite Y samples gave better catalytic activity to produce liquid products after being treated by NaOH. The sample ADY0.5 managed to produce 6.12% of 1-isopropyl-2,4-dimethylbenzene that has good potential to be processed into fuel.
Optimizing Natural Deep Eutectic Solvent Citric Acid-Glucose Based Microwave-Assisted Extraction of Total Polyphenols Content from Eleutherine bulbosa (Mill.) Bulb Bohari Yusuf; Selvi Jumiatul Astati; Mirhansyah Ardana; Herman Herman; Arsyik Ibrahim; Laode Rijai; Firzan Nainu; Islamudin Ahmad
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.58467

Abstract

Application of natural deep eutectic solvent (NADES) citric acid-glucose-based microwave-assisted extraction (MAE) method for total polyphenol content (TPC) enriches the use of Eleutherine bulbosa (Mill.) bulb more widely and commercially. Therefore, this study aims to optimize NADES citric acid-glucose-based MAE on the TPC from E. bulbosa bulbs using response surface methodology (RSM). In the present study, the dried sample of E. bulbosa bulb was extracted using the NADES based MAE. Determination of TPC was conducted using Folin-Ciocalteau reagent and standard gallic acid, then measured using a UV-Vis spectrophotometer at 761 nm. Extraction condition optimization of the NADES based MAE method was performed using RSM with Box Behnken Design (four-factors-three-levels and 29 runs) on Design Expert v12. Based on the results study, the optimum condition extraction on the TPC enrichment was obtained at the NADES ratio (citric acid: glucose) 1:1 g/g; solid-liquid ratio 1:8 g/mL; extraction time of 15 min; and 270 Watt microwave power. The confirmation test and scale-up (50 g samples) were obtained with a 61.63 ± 2.23 mg GA/g sample.
Purification of Curcuminoids from Natural Deep Eutectic Solvents (NADES) Matrices Using Chromatography-Based Separation Methods Orchidea Rachmaniah; Muhammad Rifqy Muhsin; Angga Widya Putra; Muhammad Rachimoellah
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.58935

Abstract

Curcuminoids can be successfully extracted from Curcuma zedoaria using natural deep eutectic solvents (NADES) as extraction solvents. However, a mixture of extracted curcuminoids, NADES, and impurities from C. zedoaria was obtained as a slurry at the end of the extraction process. Therefore, further separation and purification were required to obtain the extracted compound in high purity. Herein, two purification methods based on classical column chromatography (CCC) and solid-phase extraction (SPE), were evaluated for the purification of curcuminoids from NADES matrices after extraction. Choline chloride–malic acid–water (CCMA–H2O) and choline chloride–citric acid–water (CCCA–H2O) in the molar ratio of 1:1:18 were selected as NADES matrices due to their high solubility and stabilization capability for curcuminoids. Ethanol-conditioned silica gel (60–200 µm) was applied as the bed resin for CCC, and a C18 cartridge was used for SPE. Acetonitrile/0.1% acetic acid, water/0.1% acetic acid, and iso-propanol/0.1% acetic acid were used as mobile phases for CCC. For SPE, methanol/0.05% acetic acid and water/0.05% acetic acid were applied in the conditioning step, water/0.05% acetic acid in the washing step, and methanol/acetonitrile (1:1) in the eluting step. The SPE method produced higher recovery of curcuminoids from the CCCA–H2O and CCMA–H2O matrices (75.27% and 73.40%, respectively) compared to CCC (51.9% and 61.0%, respectively). After removing the NADES constituents from the crude extract of curcuminoids, recrystallization was attempted.
Synthesis of Graphite Paste/Molecularly Imprinted Polymer (MIP) Electrodes Based on Polyeugenol as a Glucose Sensor with Potentiometric Method Muhammad Cholid Djunaidi; Mei Dian Risda Afriani; Gunawan Gunawan; Miratul Khasanah
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.58964

Abstract

Diabetes mellitus is a chronic disease in which the body is unable to metabolize carbohydrates, fats, and proteins. In this study, eugenol was polymerized and then contacted with glucose and crosslinked using polyethylene glycol diglycidyl ether (PEGDE). The resulted PE-Glucose-PEGDE was eluted using ethanol to form MIP-Glucose. It was then characterized by FTIR, SEM, electrodes using the Eutech 510 potentiostat and UV-Vis spectrophotometer. The result of polyeugenol synthesis is a reddish-brown powder with a yield of 99.90% and a molecular weight of 6318.033 g/mol. UV-Vis spectrophotometer analysis showed that the contacted glucose was 2152.505 ppm. SEM results showed differences in the surface morphology of the material, indicating the formation of cavities in MIP and ESM, while no cavities are found in NIP and ESN. The electrode optimization resulted in the best composition ratio of MIP 1 mol: paraffin: graphite, respectively of 20:35:45. The resulting electrode has a Nernst factor of 20.24 mV/decade with a measurement range of 10–5–10–1 M, a limit of detection value of 8.363 × 10–5 M, and the value of the selectivity coefficient (Kij) of the electrodes in a (10–5–10–1) M fructose solution was 0.3733; 0.23048; 0.17864; 0.12359; 0.1073.
Ionic Surfactant Enhancement of Clay Properties for Heavy Metals Adsorption: Kinetics and Isotherms Adekeye Damilola Kayode; Asaolu Samuel Sunday; Adefemi Samuel Oluyemi; Ibigbami Olayinka Abidemi; Akinsola Abiodun Folasade; Awoniyi Marcus Gbolahan; Popoola Olugbenga Kayode
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.59480

Abstract

The global health problems arising from ingesting toxic metals necessitate the quest for developing efficient materials for their remediation. Surface properties of raw kaolinite clay collected from Ire-Ekiti, South-western Nigeria, were improved by modification using sodium dodecyl sulphate (SDS) for the adsorptive removal of Pb, Cr, Ni and Cu from their respective aqueous solution. The raw and modified clays were characterized by X-ray fluorescence, Fourier transformed infrared spectrometry, Scanning electron microscope coupled with EDX and Particle induced x-ray emission technique. A batch adsorption study was used to examine the performance efficiency of the modified clay. Optimization of adsorption conditions like temperature, particle size, concentration, agitation time and pH was performed. The clay after modification showed improved surface properties such as increased pore diameter and number. Freundlich, Langmuir and Temkin isotherm models were applied to explicate the adsorption processes, while Pseudo-First order, Pseudo-Second order and the Elovich kinetic models were used to predict possible mechanisms driving the adsorption processes. The adsorption processes driven by chemical mechanisms involved series of complex mechanisms that include ion exchange, direct bonding and surface complexation other than precipitation. The percentage removal of the metals by the modified clay soil reached the values of 98.53, 94.50, 73.82, and 80.40 for Pb, Cu, Ni and Cr.
Comparing the Chemical Characteristics of Pectin Isolated from Various Indonesian Fruit Peels Siti Susanti; Anang Mohamad Legowo; Nurwantoro Nurwantoro; Silviana Silviana; Fahmi Arifan
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.59799

Abstract

The Indonesian pectin manufacturing industry is underdeveloped, and pectin is imported to meet its increasing demand; we attempted to isolate pectins from various fruit peels, such as orange peel (OP), papaya peel (PP), mango peel (MP), watermelon peel (WP), and chayote peel (CP) and investigated their chemical characteristics (equivalent weight of the extracted pectins and their moisture, ash, methoxyl, and galacturonic acid (GA) contents). Acid extraction, purification, precipitation, and drying processes were used to process the isolated pectins. We examined their chemical properties for conformance to quality standards advised by the International Pectin Producers Association (IPPA). The moisture (except OP pectin) and ash contents (except PP pectin) of the extracted pectins were within the limit set by IPPA. However, the equivalent weight (W eq) of any of the isolated pectins did not satisfy IPPA standards. The methoxyl contents of the pectins isolated from OP, WP, and CP satisfied IPPA standards. High methoxyl pectins were isolated from PP and MP. The galacturonic acid contents of the isolated pectins were higher than the acceptable limit of the GA level. Thus, OP, PP, MP, WP, and CP are potential sources of pectin.
Synthesis of Low TENORM Zirconium Sulfate from ZrO(OH)2 with Sulfuric Acid Rahmatika Alfia Amliliana; Muzakky Muzakky
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60298

Abstract

Zirconium sulfate (ZS) has become one of the alternative chemical compounds for substituting traditional tannery substances using chromium(III) which was not environmentally friendly. The purpose of this research was to synthesize ZS from ZrO(OH)2 using H2SO4 with low Technologically Naturally Occurring Radioactive Material (TENORM) content. This ZS synthesis process shortened the old processing flow at which plenty of chemical reactors were used. The results showed that with 300 mg of feed, 600 mL of 95% H2SO4, at a temperature of 250 °C, the contact time of 150 min, the obtained conversion was 77.76%. Furthermore, in this 95% acid leaching reactor, the SiO2 content was still 2.79% and it was not TENORM free yet, but the FTIR and XRD images were in accordance with BDH standards. Moreover, the quenching process results had been free of SiO2 and TENORM content, but they still contained 1.48% HfO2. The surface of the TEM images from the quenching results had been in the form of elongated and transparent crystals. The result of the economic feasibility analysis showed that the new ZS synthesis process was more economical or profitable when it was compared to the old ZS synthesis process, with a BCR value of 1.258.
The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60413

Abstract

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.
Formulation of Blush Preparations by Using Natural Coloring from Red Beetroot Extract (Beta vulgaris L.) Suci Wulan Sari; Ratna Djamil; Faizatun Faizatun
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60414

Abstract

Beetroot (Beta vulgaris L.) has compounds that can be used for body health, beauty skincare, food additives, and much more. This research was aimed to prepare the dry extract of beetroot and formulate it into a loose powder, compact powder, and cream. The preparation was started by adding 2, 4, or 6% of dry extract, then blending the pulp and drying the resultant residue using a freeze dryer. Testing on color homogeneity, polishing, breakage, pH stability, color stability, and the hedonic test was carried out to determine the product quality. The initial result of phytochemical screening showed it might contain flavonoids, alkaloids, saponins, tannins, triterpenoids, steroids, and quinones. The color stability test performed at 30 °C showed that the cream was unstable while other forms showed fair stability at 8 °C. All dosage forms were homogeneous and could be applied easily. The breakage test showed no fractures. The pH remained stable for all formulas (between 3–5) after 28 days of storage. The color stability test showed that the significant discoloration only happened to the loose powder and cream. The hedonic test showed that the compact powder with a concentration of 6% was the most preferred formula by users.
Synthesis of Fe(II)/Co(II)-Fused Triphenyl Porphyrin Dimer as Candidate for Oxygen Reduction Reaction Catalyst Atmanto Heru Wibowo; Anggit Pradifta; Abu Masykur; Ken-ichi Yamashita; Yosuke Tani; Ari Yustisia Akbar; Takuji Ogawa
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.61671

Abstract

This paper reports the synthesis of Fe(II)/Co(II) fused triphenyl porphyrin dimers as candidate of hybrid organic metal electrocatalyst. The synthesis was conducted in five-step reactions using the starting materials pyrrole and benzaldehyde. The fuse oxidative reaction was done via free-base form of triphenyl porphyrin to omit metal insertions/removals of intermediate products. This strategy is very beneficial for the synthesis of metal fused triphenyl porphyrin that needs less reactions where phenyliodine(III) bis(trifluoroacetate) (PIFA) was successfully deployed in the oxidative reaction of two free-base triphenyl porphyrins. Here, the comparisons of NMR spectra were presented to see the changes of the starting material to the product. Initial electrochemical tests showed that reduction current of planar structure of Fe/Co fused triphenyl porphyrin dimer was on the potential range at -1.10 V to 0.45 V vs Au. Fe-fused triphenyl porphyrin dimer with 7.58 × 10–4 A (-1.05 V) showed slightly better performance than Co-fused triphenyl porphyrin dimer with 5.67 × 10–4 A (-0.97 V).

Page 1 of 3 | Total Record : 25


Filter by Year

2021 2021


Filter By Issues
All Issue Vol 26, No 2 (2026) Vol 26, No 1 (2026) Vol 25, No 5 (2025) Vol 25, No 4 (2025) Vol 25, No 3 (2025) Vol 25, No 2 (2025) Vol 25, No 1 (2025) Vol 24, No 6 (2024) Vol 24, No 5 (2024) Vol 24, No 4 (2024) Vol 24, No 3 (2024) Vol 24, No 2 (2024) Vol 24, No 1 (2024) Vol 23, No 6 (2023) Vol 23, No 5 (2023) Vol 23, No 4 (2023) Vol 23, No 3 (2023) Vol 23, No 2 (2023) Vol 23, No 1 (2023) Vol 22, No 6 (2022) Vol 22, No 5 (2022) Vol 22, No 4 (2022) Vol 22, No 3 (2022) Vol 22, No 1 (2022) Vol 22, No 2 (2022) Vol 21, No 6 (2021) Vol 21, No 5 (2021) Vol 21, No 4 (2021) Vol 21, No 3 (2021) Vol 21, No 2 (2021) Vol 21, No 1 (2021) Vol 20, No 6 (2020) Vol 20, No 5 (2020) Vol 20, No 4 (2020) Vol 20, No 3 (2020) Vol 20, No 2 (2020) Vol 20, No 1 (2020) Vol 19, No 4 (2019) Vol 19, No 3 (2019) Vol 19, No 2 (2019) Vol 19, No 1 (2019) Vol 18, No 4 (2018) Vol 18, No 3 (2018) Vol 18, No 2 (2018) Vol 18, No 1 (2018) Vol 17, No 3 (2017) Vol 17, No 2 (2017) Vol 17, No 1 (2017) Vol 16, No 3 (2016) Vol 16, No 2 (2016) Vol 16, No 1 (2016) Vol 15, No 3 (2015) Vol 15, No 2 (2015) Vol 15, No 1 (2015) Vol 14, No 3 (2014) Vol 14, No 2 (2014) Vol 14, No 1 (2014) Vol 13, No 3 (2013) Vol 13, No 2 (2013) Vol 13, No 1 (2013) Vol 12, No 3 (2012) Vol 12, No 2 (2012) Vol 12, No 1 (2012) Vol 11, No 3 (2011) Vol 11, No 2 (2011) Vol 11, No 1 (2011) Vol 10, No 3 (2010) Vol 10, No 2 (2010) Vol 10, No 1 (2010) Vol 9, No 3 (2009) Vol 9, No 2 (2009) Vol 9, No 1 (2009) Vol 8, No 3 (2008) Vol 8, No 2 (2008) Vol 8, No 1 (2008) Vol 7, No 3 (2007) Vol 7, No 2 (2007) Vol 7, No 1 (2007) Vol 6, No 3 (2006) Vol 6, No 2 (2006) Vol 6, No 1 (2006) Vol 5, No 3 (2005) Vol 5, No 2 (2005) Vol 5, No 1 (2005) Vol 4, No 3 (2004) Vol 4, No 2 (2004) Vol 4, No 1 (2004) Vol 3, No 3 (2003) Vol 3, No 2 (2003) Vol 3, No 1 (2003) Vol 2, No 3 (2002) Vol 2, No 2 (2002) Vol 2, No 1 (2002) Vol 1, No 3 (2001) Vol 1, No 2 (2001) Vol 1, No 1 (2001) Article in press ARTICLE IN PRESS More Issue