cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Chemistry
ISSN : 14119420     EISSN : 24601578     DOI : -
Indonesian Journal of Chemistry is an International, peer-reviewed, open access journal that publishes original research articles, review articles, as well as short communication in all areas of chemistry including applied chemistry. The journal is accredited by The Ministry of Research, Technology and Higher Education (RISTEKDIKTI) No : 21/E/KPT/2018 (in First Rank) and indexed in Scopus since 2012. Since 2018 (Volume 18), Indonesian Journal of Chemistry publish four issues (numbers) annually (February, May, August and November).
Arjuna Subject : -
Articles 2,006 Documents
Comparing the Chemical Characteristics of Pectin Isolated from Various Indonesian Fruit Peels Siti Susanti; Anang Mohamad Legowo; Nurwantoro Nurwantoro; Silviana Silviana; Fahmi Arifan
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.59799

Abstract

The Indonesian pectin manufacturing industry is underdeveloped, and pectin is imported to meet its increasing demand; we attempted to isolate pectins from various fruit peels, such as orange peel (OP), papaya peel (PP), mango peel (MP), watermelon peel (WP), and chayote peel (CP) and investigated their chemical characteristics (equivalent weight of the extracted pectins and their moisture, ash, methoxyl, and galacturonic acid (GA) contents). Acid extraction, purification, precipitation, and drying processes were used to process the isolated pectins. We examined their chemical properties for conformance to quality standards advised by the International Pectin Producers Association (IPPA). The moisture (except OP pectin) and ash contents (except PP pectin) of the extracted pectins were within the limit set by IPPA. However, the equivalent weight (W eq) of any of the isolated pectins did not satisfy IPPA standards. The methoxyl contents of the pectins isolated from OP, WP, and CP satisfied IPPA standards. High methoxyl pectins were isolated from PP and MP. The galacturonic acid contents of the isolated pectins were higher than the acceptable limit of the GA level. Thus, OP, PP, MP, WP, and CP are potential sources of pectin.
Synthesis of Low TENORM Zirconium Sulfate from ZrO(OH)2 with Sulfuric Acid Rahmatika Alfia Amliliana; Muzakky Muzakky
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60298

Abstract

Zirconium sulfate (ZS) has become one of the alternative chemical compounds for substituting traditional tannery substances using chromium(III) which was not environmentally friendly. The purpose of this research was to synthesize ZS from ZrO(OH)2 using H2SO4 with low Technologically Naturally Occurring Radioactive Material (TENORM) content. This ZS synthesis process shortened the old processing flow at which plenty of chemical reactors were used. The results showed that with 300 mg of feed, 600 mL of 95% H2SO4, at a temperature of 250 °C, the contact time of 150 min, the obtained conversion was 77.76%. Furthermore, in this 95% acid leaching reactor, the SiO2 content was still 2.79% and it was not TENORM free yet, but the FTIR and XRD images were in accordance with BDH standards. Moreover, the quenching process results had been free of SiO2 and TENORM content, but they still contained 1.48% HfO2. The surface of the TEM images from the quenching results had been in the form of elongated and transparent crystals. The result of the economic feasibility analysis showed that the new ZS synthesis process was more economical or profitable when it was compared to the old ZS synthesis process, with a BCR value of 1.258.
The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60413

Abstract

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.
Formulation of Blush Preparations by Using Natural Coloring from Red Beetroot Extract (Beta vulgaris L.) Suci Wulan Sari; Ratna Djamil; Faizatun Faizatun
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.60414

Abstract

Beetroot (Beta vulgaris L.) has compounds that can be used for body health, beauty skincare, food additives, and much more. This research was aimed to prepare the dry extract of beetroot and formulate it into a loose powder, compact powder, and cream. The preparation was started by adding 2, 4, or 6% of dry extract, then blending the pulp and drying the resultant residue using a freeze dryer. Testing on color homogeneity, polishing, breakage, pH stability, color stability, and the hedonic test was carried out to determine the product quality. The initial result of phytochemical screening showed it might contain flavonoids, alkaloids, saponins, tannins, triterpenoids, steroids, and quinones. The color stability test performed at 30 °C showed that the cream was unstable while other forms showed fair stability at 8 °C. All dosage forms were homogeneous and could be applied easily. The breakage test showed no fractures. The pH remained stable for all formulas (between 3–5) after 28 days of storage. The color stability test showed that the significant discoloration only happened to the loose powder and cream. The hedonic test showed that the compact powder with a concentration of 6% was the most preferred formula by users.
Synthesis of Fe(II)/Co(II)-Fused Triphenyl Porphyrin Dimer as Candidate for Oxygen Reduction Reaction Catalyst Atmanto Heru Wibowo; Anggit Pradifta; Abu Masykur; Ken-ichi Yamashita; Yosuke Tani; Ari Yustisia Akbar; Takuji Ogawa
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.61671

Abstract

This paper reports the synthesis of Fe(II)/Co(II) fused triphenyl porphyrin dimers as candidate of hybrid organic metal electrocatalyst. The synthesis was conducted in five-step reactions using the starting materials pyrrole and benzaldehyde. The fuse oxidative reaction was done via free-base form of triphenyl porphyrin to omit metal insertions/removals of intermediate products. This strategy is very beneficial for the synthesis of metal fused triphenyl porphyrin that needs less reactions where phenyliodine(III) bis(trifluoroacetate) (PIFA) was successfully deployed in the oxidative reaction of two free-base triphenyl porphyrins. Here, the comparisons of NMR spectra were presented to see the changes of the starting material to the product. Initial electrochemical tests showed that reduction current of planar structure of Fe/Co fused triphenyl porphyrin dimer was on the potential range at -1.10 V to 0.45 V vs Au. Fe-fused triphenyl porphyrin dimer with 7.58 × 10–4 A (-1.05 V) showed slightly better performance than Co-fused triphenyl porphyrin dimer with 5.67 × 10–4 A (-0.97 V).
The Effects of Manganese Dopant Content and Calcination Temperature on Properties of Titania-Zirconia Composite Muhamad Imam Muslim; Rian Kurniawan; Mokhammad Fajar Pradipta; Wega Trisunaryanti; Akhmad Syoufian
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.61900

Abstract

The effects of dopant content and calcination temperature on Mn-doped TiO2-ZrO2 structure and properties were successfully investigated. Composite of Mn-doped titania-zirconia was synthesized by sol-gel method. Titanium(IV) isopropoxide was used as the precursor of TiO2, while zirconiapowder was used as another semiconductor. MnCl2∙4H2O was used as the source of dopant in this study. Various amounts of manganese were incorporated into TiO2-ZrO2 and calcination was performed at temperatures of 500, 700 and 900 °C. Synthesized composites were characterized by Fourier-transform infrared spectroscopy (FTIR), specular reflectance UV-Vis spectroscopy (SR UV-Vis), X-ray diffraction method (XRD) and scanning electron microscopy equipped with X-ray energy dispersive spectroscopy (SEM-EDX). The results showed that Mn-doped TiO2-ZrO2 with the lowest bandgap (2.78 eV) was achieved with 5% of Mn dopant and calcined at 900 °C, while Mn-doped TiO2-ZrO2 with the highest bandgap (3.12 eV) was achieved with 1% of Mn dopant content calcined at 500 °C.
Synthesis and Characterization of Ferrofluid-Chitosan-Au Nanoparticles as Brachytherapy Agent Candidate Muflikhah Muflikhah; Ahmad Marzuki Ramadhan; Maria Christina Prihatiningsih; Mujamilah Mujamilah; Aloma Karo Karo
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.62191

Abstract

Brachytherapy is expected to be a solution to the side effect of other cancer therapy methods. This study aims to synthesize ferrofluids (FF)-Chitosan-Au (so-called cold synthesis) as the initial step before using 198Au that is expected to be a targeted and controllable brachytherapy agent. In this research, the preparation of FF-Chitosan was done by the co-precipitation method. Furthermore, FF-Chitosan-Au was produced via self-assembly by the adsorption method. The adsorption followed the Langmuir model with a maximum capacity of 30.24 mg Au/g FF-Chitosan. The X-Ray Diffractometion (XRD) of FF-Chitosan-Au confirms the existence of Au. Particle Size Analyzer (PSA) indicates FF-Chitosan-Au has an average size of 82.93 nm with a polydispersity index of 0.175. Morphological and distribution analysis of nanoparticles using Scanning Electron Microscope (SEM) shows that nanoparticles have a homogenous spherical shape. Vibrating Sample Magnetometer (VSM) measurement confirms the superparamagnetic properties of FF-Chitosan and FF-Chitosan-Au with a saturated magnetization of 80.48 and 74.52 emu/g, respectively. The overall results are associated with biomedical requirements, such as high saturation magnetization and good polydispersity. The synthesis can also be applied to produce FF-Chitosan-198Au that has great potential as a brachytherapy agent, which will reduce the nuclear waste and potential danger of radiation received by workers during synthesis.
The Origin, Physicochemical Properties, and Removal Technology of Metallic Porphyrins from Crude Oils Jumina Jumina; Yehezkiel Steven Kurniawan; Dwi Siswanta; Bambang Purwono; Abdul Karim Zulkarnain; Agustinus Winarno; Joko Waluyo; Johan Syafri Mahathir Ahmad
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.62521

Abstract

Crude oil is an indispensable energy feedstock for daily activities, although some amounts of metallic porphyrins components with undesired characteristics have been identified. These constituents are assumed to originate from the geochemical process of chlorophyll and heme derivatives. In addition, their chemical structures have been thoroughly characterized using spectroscopy techniques, while several analytical methods were adopted in the detection and concentration quantification in the crude oils. The metallic porphyrins have several demerits, including the deactivation of used catalysts, contamination of the treated petrochemical products, and corrosion of the industrial equipment. Also, the removal process is considered challenging due to the strong interaction with the asphaltene fraction of crude oil. This review article, therefore, provides brief information on the origin, physicochemical properties, and possible removal technology of metallic porphyrins from crude oil samples. Besides, a better understanding of chemistry contributes a useful insight towards the development and establishment of better futuristic processing technology.
The Atmospheric Corrosion of Structural Steel after Exposure in the Palm Oil Mill Industry Area of Aceh-Indonesia Muhammad Zulfri; Nurdin Ali; Husaini Husaini; Sri Mulyati; Iskandar Hasanuddin
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.62769

Abstract

The major cause of early failure in the infrastructures of the palm oil industry in Aceh, Indonesia has been discovered to be the corrosion caused by air pollution from exhaust fumes of the factory plants. Therefore, this research was conducted to analyze the effect of the atmospheric corrosion of the structural steel used in the palm oil mill industry. The five types of structural steel used as samples include strip, l-shape, round bar, plate, and SAPH 610 low carbon steel with a carbon content of 0.18%. These specimens were cleansed from dirt, scaled, and rubbed with sandpaper to achieve a grid of 600, later washed with fresh water and rinsed with alcohol, and subsequently exposed to the environment in PT ASN and PT AKTS palm oil mills for 12 months. Moreover, they were placed on a measuring tray for exposure and the corrosion rate was recorded once a month using the mass loss method in line with the ASTM G50. The results showed the steel construction with a round bar shape was more resistant to atmospheric corrosion and the remaining samples were also observed to be safe and relatively resistant based on their classification as being outstanding (< 1 mpy).
Various Adsorbents for Removal of Rhodamine B Dye: A Review Zainab Mohammad Saigl
Indonesian Journal of Chemistry Vol 21, No 4 (2021)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.62863

Abstract

Lately, there has been an increase in dye manufacturing, resulting in increased environmental pollution. Recent studies show a wide availability of usage adsorbents, including banana peels, potatoes, algae, etc. Food and Drug Administration prohibited the use of Rhodamine B (RhB) for its toxicity and harmful effects. Therefore, this study presents a wide range of non-conventional low-cost alternative adsorbents to remove RhB dye from wastewater. It has been observed that the mechanism of the dye adsorption is focused on kinetics, isotherm, and thermodynamics models, which depend on the chemical nature of the materials and various physicochemical experimental conditions such as solution pH, initial dye concentration, adsorbent dosage, and temperature of the system. The kinetic data of adsorption of RhB dye usually follow the pseudo-first-order and pseudo-second-order kinetic models. Several studies revealed that Langmuir and Freundlich adsorption isotherm models are frequently used to evaluate the adsorption capacity of the adsorbents. Furthermore, thermodynamic examination showed that RhB adsorption was endothermic and unconstrained in nature. Thus, both photocatalytic degradation and adsorption methods offer good potential to remove RhB dye from industrial effluents. The work is in progress to evaluate the possibility of using other modified waste biomass for industrial pollution control.

Filter by Year

2001 2026


Filter By Issues
All Issue Vol 26, No 2 (2026) Vol 26, No 1 (2026) Vol 25, No 5 (2025) Vol 25, No 4 (2025) Vol 25, No 3 (2025) Vol 25, No 2 (2025) Vol 25, No 1 (2025) Vol 24, No 6 (2024) Vol 24, No 5 (2024) Vol 24, No 4 (2024) Vol 24, No 3 (2024) Vol 24, No 2 (2024) Vol 24, No 1 (2024) Vol 23, No 6 (2023) Vol 23, No 5 (2023) Vol 23, No 4 (2023) Vol 23, No 3 (2023) Vol 23, No 2 (2023) Vol 23, No 1 (2023) Vol 22, No 6 (2022) Vol 22, No 5 (2022) Vol 22, No 4 (2022) Vol 22, No 3 (2022) Vol 22, No 1 (2022) Vol 22, No 2 (2022) Vol 21, No 6 (2021) Vol 21, No 5 (2021) Vol 21, No 4 (2021) Vol 21, No 3 (2021) Vol 21, No 2 (2021) Vol 21, No 1 (2021) Vol 20, No 6 (2020) Vol 20, No 5 (2020) Vol 20, No 4 (2020) Vol 20, No 3 (2020) Vol 20, No 2 (2020) Vol 20, No 1 (2020) Vol 19, No 4 (2019) Vol 19, No 3 (2019) Vol 19, No 2 (2019) Vol 19, No 1 (2019) Vol 18, No 4 (2018) Vol 18, No 3 (2018) Vol 18, No 2 (2018) Vol 18, No 1 (2018) Vol 17, No 3 (2017) Vol 17, No 2 (2017) Vol 17, No 1 (2017) Vol 16, No 3 (2016) Vol 16, No 2 (2016) Vol 16, No 1 (2016) Vol 15, No 3 (2015) Vol 15, No 2 (2015) Vol 15, No 1 (2015) Vol 14, No 3 (2014) Vol 14, No 2 (2014) Vol 14, No 1 (2014) Vol 13, No 3 (2013) Vol 13, No 2 (2013) Vol 13, No 1 (2013) Vol 12, No 3 (2012) Vol 12, No 2 (2012) Vol 12, No 1 (2012) Vol 11, No 3 (2011) Vol 11, No 2 (2011) Vol 11, No 1 (2011) Vol 10, No 3 (2010) Vol 10, No 2 (2010) Vol 10, No 1 (2010) Vol 9, No 3 (2009) Vol 9, No 2 (2009) Vol 9, No 1 (2009) Vol 8, No 3 (2008) Vol 8, No 2 (2008) Vol 8, No 1 (2008) Vol 7, No 3 (2007) Vol 7, No 2 (2007) Vol 7, No 1 (2007) Vol 6, No 3 (2006) Vol 6, No 2 (2006) Vol 6, No 1 (2006) Vol 5, No 3 (2005) Vol 5, No 2 (2005) Vol 5, No 1 (2005) Vol 4, No 3 (2004) Vol 4, No 2 (2004) Vol 4, No 1 (2004) Vol 3, No 3 (2003) Vol 3, No 2 (2003) Vol 3, No 1 (2003) Vol 2, No 3 (2002) Vol 2, No 2 (2002) Vol 2, No 1 (2002) Vol 1, No 3 (2001) Vol 1, No 2 (2001) Vol 1, No 1 (2001) Article in press ARTICLE IN PRESS More Issue