cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
suranto
Contact Email
editors@smujo.id
Phone
-
Journal Mail Official
editors@smujo.id
Editorial Address
unsjournals@gmail.com
Location
Kota surakarta,
Jawa tengah
INDONESIA
Biodiversitas Journal of Biological Diversity
Published by Universitas Sebelas Maret
ISSN : 1412033X     EISSN : 20854722     DOI : https://doi.org/10.13057/biodiv/d230231
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
The Biodiversitas Journal was first published in 2000 by the Department of Biology, FMNS, Universitas Sebelas Maret, Surakarta, Indonesia, then in 2006 it was co-published by the Society for Indonesian Biodiversity and that department; since 2017 it was also hosted by Smujo. From 2003-2012 it was accredited by DGHE, Ministry of Education, R.I., since 2014 was indexed by Scopus, where DOAJ and Google Scholar was indexed first.
Arjuna Subject : Biokimia, Genetika dan Biologi Molekuler - Biokimia, Genetika dan Biologi Molekuler (Lain-Lain)
Articles 6,315 Documents
 411   412   413   414   415 
Genetic differentiation among Batak fish populations (Neolissochilus sumatranus, Tor douronensis, and Tor soro) in North Sumatra, Indonesia revealed by RAPD markers TERNALA ALEXANDER BARUS; HESTI WAHYUNINGSIH; BERTUA NOVITA SIMANJUNTAK; RISSA HERAWATI GINTING; AGUNG SETIA BATUBARA; ADRIAN HARTANTO
Biodiversitas Journal of Biological Diversity Vol. 24 No. 3 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240301

Abstract

Abstract. Barus TA, Wahyuningsih H, Simanjuntak BN, Ginting RH, Batubara AS, Hartanto A. 2023. Genetic differentiation among Batak fish populations (Neolissochilus sumatranus, Tor douronensis, and Tor soro) in North Sumatra, Indonesia was revealed by RAPD markers. Biodiversitas 24: 1327-1332. Mahseer or Batak fish species within the genera of Neolissochilus and Tor are highly valued as a source of food for local communities, especially in North Sumatra. Assessment of genetic differentiation of the Batak fish population, namely Tor soro, Tor douronensis, and Neolissochilus sumatranus in the North Sumatra Rivers, has been conducted. The objective of this study was to determine the possible genetic divergence among congeneric fish and supply the genetic information for the design of conservation strategies. Fish specimens were collected from three rivers in North Sumatra Bahorok River (Langkat District), Asahan River (Toba Samosir District), and Batangtoru River (South Tapanuli District). The genetic analysis employed the Random Amplified Polymorphism DNA (RAPD) markers using a set of RAPD primers: OPA-2, OPA-3, OPA-6, OPA-7, OPA-9, OPA-11, and OPA-17. The amplified fragments were analyzed using the Numerical Taxonomy and Multivariate Analysis System (NTSYS) 2.00 program to construct the dendrogram of relationship among accessions. The genetic similarity coefficient among species of T. soro, T. douronensis, and N. sumatranus reached 0.44-0.86, with the lowest similarity at 44%. The cluster analysis indicated that T. douronensis is more closely related to N. sumatranus than T. soro based on the grouping of accessions. There is an indication of natural hybrids occurrence between N. sumatranus and T. soro populations despite the different habitats and locations of sampling. Our study revealed that using RAPD markers may discriminate inter- and intraspecific Batak fish populations in North Sumatra.
Short Communication: Avian sanctuary within the city in Timaco Hill, Cotabato City, Bangsamoro Autonomous Region in Muslim Mindanao (BARMM), Mindanao Island, Philippines Peter Jan de Vera; John Paul Catipay; Marian Dara Tagoon; Elsa May Delima-Baron; Benito Anthony Pingoy
Biodiversitas Journal of Biological Diversity Vol. 24 No. 2 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240240

Abstract

Abstract. Vera PJD, Catipay JPC, Tagoon MDT, Baron EMD, Pinggoy BA. 2023. Short Communication: Avian sanctuary within the city in Timaco Hill, Cotabato City, Bangsamoro Autonomous Region in Muslim Mindanao (BARMM), Mindanao Island, Philippines. Biodiversitas 24: 1004-1009. The habitats provided by urban green spaces are vital for conserving different wildlife species, especially birds. Although several studies outside the Philippines highlight the value of urban green spaces, including urban hills, as essential bird sanctuaries, limited accessible information exists in the Philippines. To date, no published information is available about birds in the urban green spaces of Cotabato City, including Timaco Hill. This gap highlights the need to conduct an avifaunal inventory in the area. In this preliminary, rapid assessment, two field observers documented bird species through vantage point field observations from June 06-13, 2022. A total of forty-three species of birds were documented. Ten avian species recorded are endemic, including the Philippine duck (Anas luzonica), which is currently listed in the vulnerable category based on the IUCN Red List of Threatened Species. The results of the current avifaunal inventory highlight the value of Timaco Hill as an important sanctuary of birds in Cotabato City. Results can also be used to promote the declaration of this urban hill as an eco-tourism site. The area may require prompt protection measures to sustain its capacity to serve as a bird sanctuary. More intensive surveys are also necessary to ascertain if the current count presented in the study is the complete list of birds of Timaco Hill.
Characterization and identification of Trichoderma on shallots isolated from three elevation regions in West Sumatra, Indonesia EKA SUSILA; FRI MAULINA; DENI EMILDA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 4 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240416

Abstract

Abstract. Susila E, Maulina F, Emilda D. 2023. Characterization and identification of Trichoderma on shallots isolated from three elevation regions in West Sumatra, Indonesia. Biodiversitas 24: 2064-2071. Various microorganisms are found in the rhizosphere of plants. The species of Trichoderma exhibited many benefits to plants such as biological control of many crop diseases and their causing agents. This study aim was to explore, collect, and identify species of Trichoderma from shallot rhizosphere based on morphological characters and molecular techniques. The research was carried out from March to October 2021 at Biology Laboratories Agricultural State Polytechnic of Payakumbuh and Plant Protection Laboratory, Indonesian Tropical Fruits Research Institute (ITFRI) for morphological observation, and Molecular Laboratories, ITFRI for molecular identification. Samples were collected from Alahan Panjang (1700 m above sea level), Solok (400m asl) and Kambang (< 200 m asl) by using Stratified Random Sampling method. The isolates of Trichoderma species were cultured on Potato Dextose Agar (PDA). Three Trichoderma sp. from shallot rhizosphere were obtained and identified. Four specific primer pairs (T2A F-T2A R, T2 F-T2 R, T1 F-T1 R and Th1 F-Th1 R) were used for molecular identification. The amplification results of three isolates of Trichoderma spp. using four pairs of specific primers showed that the three isolates tested amplified only in the T. asperellum primer pair. The results showed that Trichoderma spp. origin of shallot rhizosphere from three locations (Alahan Panjang, Solok and Kambang) is identified as one species i.e. Trichoderma asperellum.
Phytochemical analysis of Annona atemoya seed extract by HPLC and their ability to inhibit the growth of Agrobacterium tumefaciens NAJWA IBRAHIM KHALEEL AL-BARHAWEE; WJDAN SALIM QASIM; YOUSRA A. ABDLLA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 1 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240168

Abstract

Abstract. Al-Barhawee NIK, Qasim WS, Abdlla YA. 2023. Phytochemical analysis of Annona atemoya seed extract by HPLC and their ability to inhibit the growth of Agrobacterium tumefaciens. Biodiversitas 24: 603-608. The main objective of this study was to determine the effectiveness of Annona atemoya seeds crude alcoholic extract utilizing nine different concentrations (0.0020, 0.0039, 0.0060, 0.0080, and 0.00100 mg/ml). Agrobacterium tumefaciens causes crown gall disease in numerous plant crops causing significant economic losses. Medicinal plants contain chemical compounds (a group of secondary metabolites) known to have antibacterial properties. The result showed that the minimum inhibitory concentration was (0.0313 mg/ml) using agar diffusion technique, while it ranged from (0.0156-0.0313 mg/ml) in the minimal microplate inhibitory concentration test. The crude alcoholic extract of A. atemoya seeds contains alkaloids, flavonoids, glycosides, tannins, phenols, and proteins, but not saponins, based on the results of qualitative analysis of chemical components. HPLC analysis revealed that the extract contained quercitin, rutin, valine, and camphor which were found in the amount of 33.09, 139.39, 0.061, and 7.43 ppm/ml, respectively. Therefore the present finding suggests that A. atemoya seed extract may be used as a biological control to inhibit crown gall formation in plants. This is the first study of the antimicrobial activity of A. atemoya seed alcoholic extract on the growth of plant pathogenic bacteria.
DNA primer design for sex identification of Sumatran tiger body samples IKRIMA ASRORI; DJONG HON TJONG; WILSON NOVARINO; MANSYURDIN MANSYURDIN; SYAIFULLAH SYAIFULLAH; DEWI IMELDA ROESMA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 1 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240129

Abstract

Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs (bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatrae Pocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design (F= 5’ TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3) is more specific than the primers previously reported.
Effect of environmental temperature and relative humidity towards postural behavior and activity patterns of female Pongo pygmaeus at Bukit Merah Orang Utan Island, Perak, Malaysia Noramira Nozmi; Sabapathy Dharmaligam; Nur Nadiah Md Yusof; Farida Zuraina Mohd Yusof
Biodiversitas Journal of Biological Diversity Vol. 24 No. 2 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240267

Abstract

Abstract. Nozmi N, Dharmalingam S, Yusof NNM, Yusof FZM. 2023. Effect of environmental temperature and relative humidity towards postural behavior and activity patterns of female Pongo pygmaeus at Bukit Merah Orang Utan Island, Perak, Malaysia. Biodiversitas 24: 1252-1263. Variation in environmental conditions is known to have impacts on animal behavior. Previous research showed animals adapt to temperature change by altering their behavior and routine or resorting to relocation in order to survive. This study aims to determine the strength of the correlation between the environmental conditions with Bornean orangutans (Pongo pygmaeus) postural behavior and activity patterns in captivity. Focal sampling was carried out at Bukit Merah Orang Utan Island, Perak, Malaysia, for 93 days from March 2021 until June 2021 among four adult female orangutans. Four postural behaviors were observed, which are sitting, lying, clinging and standing, and four activities were selected, which are resting, feeding, playing and moving. We used RS PRO DT-3893 Vane Anemometer to determine the environmental temperature and relative humidity. The data were analyzed via Mann-Whitney U-test. Orangutans had a longer resting period (p: 0.023) and a lying period (p: 0.002) at high temperatures. The behavioral observation also shows similar findings in resting (p: 0.015) and lying duration (p: 0.001) in lower humidity. The results of this study will enhance our understanding of the behavior pattern of female orangutans in ensuring the effectiveness of enrichment activities in the future. This study will also serve as baseline data of behavioral patterns in response to variations of environmental conditions which is affecting the behavior of orangutans in captivity.
Ethnomedicinal bioprospecting of Rhizophora apiculata leaves through in silico and in vitro approaches as antioxidant, ?-glucosidase inhibitor and anticancer MADA TRIANDALA SIBERO; RUDHI PRIBADI; AMBARIYANTO AMBARIYANTO; DWI HARYANTI; VIOL DHEA KHARISMA; ARIYANTI S. DEWI; GINTUNG PATANTIS PATANTIS; DEWI S. ZILDA; RETNO MURWANI
Biodiversitas Journal of Biological Diversity Vol. 23 No. 12 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d231242

Abstract

Abstract. Sibero MT, Pribadi R, Ambariyanto A, Haryanti D, Kharisma VD, Dewi AS, Patantis G, Zilda DS, Murwani R. 2022. Ethnomedicinal bioprospecting of Rhizophora apiculata leaves through in silico and in vitro approaches as antioxidant, a-glucosidase inhibitor and anticancer. Biodiversitas 23: 6437-6447. Investigating marine natural products for biopharmaceutical development leads to a massive study of mangrove metabolites. Rhizophora apiculata is utilized as a traditional medicine by the local community in Indonesia. However, only a few studies reported the lead compounds. The aim of this study was to discover the biological properties of R. apiculata metabolites from the leaves as an antioxidant, a-glucosidase inhibitor, and anticancer agent through in vitro and in silico approaches. The leaves of R. apiculata were extracted and then fractionated using the silica-OCC method. All fractions were screened for antioxidant, a-glucosidase inhibitors, and cytotoxicity assays. Then the bioactive compounds in prospective fractions were identified using LC-HRMS. The selected compounds with ppm error <10 were applied for in silico analysis. The result of biological properties screening indicated Fr. 5 and Fr. 6 as the most potent sources of antioxidants, a-glucosidase inhibitors, and cytotoxic compounds. In total, 19 compounds were selected from two prospective fractions. The drug-likeness and bioavailability prediction results indicated that all selected compounds act as drug-like molecules. In addition, 17 were predicted to have antioxidant activity, and 15 compounds had antidiabetic activity. Moreover, 15 compounds had a more negative affinity binding than cytarabine. Molecular docking analysis showed that the mechanism of cytotoxicity against P388 Murine Leukaemia Cells was through the interaction of apigenin with protein tyrosine kinase (c-Kit) with a stronger inhibitory activity than the control drug (Cytarabine) and had the same binding site as the control (Cytarabine).
The growth of sengon (Parasarienthes falcataria) and citronella (Cymbopogon nardus) productivity performance in agroforestry system HANIFA RAHMAH; NURHENI WIJAYANTO; ARUM SEKAR WULANDARI
Biodiversitas Journal of Biological Diversity Vol. 24 No. 6 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240603

Abstract

Abstract. Rahmah H, Wijayanto N, Wulandari AS. 2023. The growth of sengon (Parasarienthes falcataria) and citronella (Cymbopogon nardus) productivity performance in agroforestry system. Biodiversitas 24: 3114-3119. Sengon is a fast-growing plant species widely planted in community forests. Sengon is widely cultivated in agroforestry systems with seasonal crops. The main obstacle to cultivation in agroforestry systems is low growth due to competition for nutrients and low absorption of sunlight. This study aims to analyze the growth of sengon varieties and citronella varieties. The research was conducted for six months in the Cikabayan field, Faculty of Forestry, IPB University, Bogor, West Java. This study consisted of two activities: (i) analyzing the effect of the two-year-old sengon variety on the growth of tree height, diameter, crown, and volume, (ii) analyzing the effect of the citronella variety on the growth and yield of citronella oil. The experiment was designed with three factors, a completely randomized design with three replications. The results showed that Sengon Solomon had higher growth than Sengon Kendal. Sengon Solomon F2 had better growth than Sengon Solomon F1 and Kendal locale. Citronella plants grown under the local stands of Sengon Kendal had the best productivity. Lemongrass variety G1 had better growth than the Sitrona 2 Agribun variety in the shaded condition of sengon stands. However, the Sitrona 2 Agribun variety's yield has a higher value than the G1 citronella variety.
Antibacterial activity of sponge-associated bacteria from Torosiaje marine area, Gorontalo, Indonesia YULIANA RETNOWATI; ABUBAKAR SIDIK KATILI
Biodiversitas Journal of Biological Diversity Vol. 24 No. 2 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240255

Abstract

Abstract. Retnowati Y, Katili AS. 2023. Antibacterial activity of sponge-associated bacteria from Torosiaje marine area, Gorontalo, Indonesia. Biodiversitas 24: 1151-1156. The marine sponge is a member of the Porifera class animal group that has the potential to produce secondary metabolites with various biological activities. These marine animals are often associated with various bacteria from the actinomycetes and non-actinomycetes groups. Currently, information about bacteria associated with sponges in Gorontalo coastal waters is still very limited. Bacteria associated with organisms from the marine environment have been explored as producers of new types of bioactive compounds. Exploring bacteria associated with sponges in the coastal waters of Gorontalo can potentially find new types of antibiotics. The aim of this study was to reveal the diversity of antibiotic-producing bacteria associated with sponges in the Torosiaje coastal area, Gorontalo. The research was carried out in the Torosiaje marine area as sponge sampling locations, including seawater physicochemical properties measurement. The sponges were identified based on morphological characteristics. The sponge-associated bacteria were isolated and screened for antibacterial potential against Escherichia coli and Staphylococcus aureus. The potential sponge-associated bacteria were identified based on a molecular approach. The result showed that a total of 10 sponge members of Demospongiae class. All ten sponge-associated bacteria were non-actinomycetes bacterial isolates that showed similar morphological characteristics. Only isolate ILM-1 associated with Coelocarteria singaporensis showed antibacterial potential in broad-spectrum mode against Escherichia coli and Staphylococcus aureus. The ILM-1 isolate was identified as Vibrio diabolicus closely related to Vibrio diabolicus strain CW-9-11-1 with a similarity index of 99.70%.
DNA barcode of seven species coral from Sepulu, Madura Island, Indonesia INSAFITRI INSAFITRI; NINING NURSALIM; NENIK KHOLILAH; EKA MAYA KURNIASIH; NI KADEK DITA CAHYANI; WAHYU ANDY NUGRAHA; AMBARIYANTO AMBARIYANTO
Biodiversitas Journal of Biological Diversity Vol. 24 No. 1 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240138

Abstract

Abstract. Insafitri, Nursalim N, Kholilah N, Kurniasih EM, Cahyani NKD, Nugraha WA, Ambariyanto A. 2023. DNA barcode of seven species coral from Sepulu, Madura Island, Indonesia. Biodiversitas 24: 317-323. Diversity of coral species is needed because it affects the disruption of coral reef ecosystems, nutrient recycling, coral reef growth and the habitat of biota that live in these ecosystems. The main constituents of coral reef ecosystems are coral animals that belong to the Anthozoa class. Sepulu waters (Madura Island), Bangkalan District, East Java Province, Indonesia, has a percentage of coral cover that is in the bad category, management of coral reefs in this area has not been the main focus and it is feared that the situation will get worse so efforts are needed to maintain coral reefs to be sustainable and better. This management effort requires an analysis of species identification. DNA barcoding of corals has never been done on corals of Sepulu waters. The purpose of this study is to find out the DNA of barcoding coral species on Sepulu waters. Genetic marker Cytochrome Oxidase I of the mitochondrial genome DNA (mtDNA) was used to analyze genetic diversity. Reconstruction of phylogenetic tree and genetic diversity were done by using software MEGA X. Research results showed that sample DBP011101 closely related to Dipsatraea maxima 99.55%, DBP011102 closely related to Porites rus 99.4%, DBP011103 closely related to Acropora hyacinthus 99.11%, DBP011104 closely related to Porites cf lichen 98.66%, DBP011106 closely related to Dipsastraea rotumana 95.37%, DBP011107 closely related to Porites horrisoni 98.81%, and DBP011108 closely related to Acropora valida 98.38%. The results of the study are the first coral barcode DNA on Sepulu waters that can help in determining coral species that are useful in managing the sustainability of coral resources, especially on Sepulu waters.

Page 413 of 632 | Total Record : 6315

 411   412   413   414   415 

Filter by Year

2000 2026


Reset
Filter By Issues
All Issue Vol. 27 No. 8 (2026) Vol. 27 No. 7 (2026) Vol. 27 No. 6 (2026) Vol. 27 No. 5 (2026) Vol. 27 No. 4 (2026) Vol. 27 No. 3 (2026) Vol. 27 No. 2 (2026) Vol. 27 No. 1 (2026) Vol. 26 No. 12 (2025) Vol. 26 No. 11 (2025) Vol. 26 No. 10 (2025) Vol. 26 No. 9 (2025) Vol. 26 No. 8 (2025) Vol. 26 No. 7 (2025) Vol. 26 No. 6 (2025) Vol. 26 No. 5 (2025) Vol. 26 No. 4 (2025) Vol. 26 No. 3 (2025) Vol. 26 No. 2 (2025) Vol. 26 No. 1 (2025) Vol. 25 No. 12 (2024) Vol. 25 No. 11 (2024) Vol. 25 No. 10 (2024) Vol. 25 No. 9 (2024) Vol. 25 No. 8 (2024) Vol. 25 No. 7 (2024) Vol. 25 No. 6 (2024) Vol. 25 No. 5 (2024) Vol. 25 No. 4 (2024) Vol. 25 No. 3 (2024) Vol. 25 No. 2 (2024) Vol. 25 No. 1 (2024) Vol. 24 No. 12 (2023) Vol. 24 No. 11 (2023) Vol. 24 No. 10 (2023) Vol. 24 No. 9 (2023) Vol. 24 No. 8 (2023) Vol. 24 No. 7 (2023) Vol. 24 No. 6 (2023) Vol. 24 No. 5 (2023) Vol. 24 No. 4 (2023) Vol. 24 No. 3 (2023) Vol. 24 No. 2 (2023) Vol. 24 No. 1 (2023) Vol. 23 No. 12 (2022) Vol. 23 No. 11 (2022) Vol. 23 No. 10 (2022) Vol. 23 No. 9 (2022) Vol. 23 No. 8 (2022) Vol. 23 No. 7 (2022) Vol. 23 No. 6 (2022) Vol. 23 No. 5 (2022) Vol. 23 No. 4 (2022) Vol. 23 No. 3 (2022) Vol. 23 No. 2 (2022) Vol. 23 No. 1 (2022) Vol. 22 No. 12 (2021) Vol. 22 No. 11 (2021) Vol. 22 No. 10 (2021) Vol. 22 No. 9 (2021) Vol. 22 No. 8 (2021) Vol. 22 No. 7 (2021) Vol. 22 No. 6 (2021) Vol. 22 No. 5 (2021) Vol. 22 No. 4 (2021) Vol. 22 No. 3 (2021) Vol. 22 No. 2 (2021) Vol. 22 No. 1 (2021) Vol. 21 No. 12 (2020) Vol. 21 No. 11 (2020) Vol. 21 No. 10 (2020) Vol. 21 No. 9 (2020) Vol. 21 No. 8 (2020) Vol. 21 No. 7 (2020) Vol. 21 No. 6 (2020) Vol. 21 No. 5 (2020) Vol. 21 No. 4 (2020) Vol. 21 No. 3 (2020) Vol. 21 No. 2 (2020) Vol. 21 No. 1 (2020) Vol. 20 No. 12 (2019) Vol. 20 No. 11 (2019) Vol. 20 No. 10 (2019) Vol. 20 No. 9 (2019) Vol. 20 No. 8 (2019) Vol. 20 No. 7 (2019) Vol. 20 No. 6 (2019) Vol. 20 No. 5 (2019) Vol. 20 No. 4 (2019) Vol. 20 No. 3 (2019) Vol. 20 No. 2 (2019) Vol. 20 No. 1 (2019) Vol. 19 No. 6 (2018) Vol. 19 No. 5 (2018) Vol. 19 No. 4 (2018) Vol. 19 No. 3 (2018) Vol. 19 No. 2 (2018) Vol. 19 No. 1 (2018) Vol. 18 No. 4 (2017) Vol. 18 No. 3 (2017) Vol. 18 No. 2 (2017) Vol. 18 No. 1 (2017) Vol. 17 No. 2 (2016) Vol. 17 No. 1 (2016) Vol. 16 No. 2 (2015) Vol. 16 No. 1 (2015) Vol. 15 No. 2 (2014) Vol. 15 No. 1 (2014) Vol. 14 No. 2 (2013) Vol. 14 No. 1 (2013) Vol. 13 No. 4 (2012) Vol. 13 No. 3 (2012) Vol. 13 No. 2 (2012) Vol. 13 No. 1 (2012) Vol. 12 No. 4 (2011) Vol. 12 No. 3 (2011) Vol. 12 No. 2 (2011) Vol. 12 No. 1 (2011) Vol. 11 No. 4 (2010) Vol. 11 No. 3 (2010) Vol. 11 No. 2 (2010) Vol. 11 No. 1 (2010) Vol. 10 No. 4 (2009) Vol. 10 No. 3 (2009) Vol. 10 No. 2 (2009) Vol. 10 No. 1 (2009) Vol. 9 No. 4 (2008) Vol. 9 No. 3 (2008) Vol. 9 No. 2 (2008) Vol. 9 No. 1 (2008) Vol. 8 No. 4 (2007) Vol. 8 No. 3 (2007) Vol. 8 No. 2 (2007) Vol. 8 No. 1 (2007) Vol. 7 No. 4 (2006) Vol. 7 No. 3 (2006) Vol. 7 No. 2 (2006) Vol. 7 No. 1 (2006) Vol. 6 No. 4 (2005) Vol. 6 No. 3 (2005) Vol. 6 No. 2 (2005) Vol. 6 No. 1 (2005) Vol. 5 No. 2 (2004) Vol. 5 No. 1 (2004) Vol. 4 No. 2 (2003) Vol. 4 No. 1 (2003) Vol. 3 No. 2 (2002) Vol. 3 No. 1 (2002) Vol. 2 No. 2 (2001) Vol. 2 No. 1 (2001) Vol. 1 No. 2 (2000) Vol. 1 No. 1 (2000) More Issue