cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 537 Documents
An Active of Extracellular Cellulose Degrading Enzyme from Termite Bacterial Endosimbiont M. Saifur Rohman; Endang Pamulatsih; Yudi Kusnadi; Triwibowo Yuwono; Erni Martani
Indonesian Journal of Biotechnology Vol 20, No 1 (2015)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (241.666 KB) | DOI: 10.22146/ijbiotech.15273

Abstract

Cellulase is an ezyme that specifically cleaves the 1,4-β-glycosidic bond of cellulose to produce thesmall fragments of simple carbohydrate. This work was aimed to characterize the extracellular cellulase fromPaenibacillus spp., which was previously isolated from macro termites, Odontotermes bhagwatii in our laboratory.Two Paenibacillus isolates were used in this experiment, namely Paenibacillus cellulositrophicus SBT1 andPaenibacillus, sp. SBT8. Analysis of the total proteins in the supernatants showed that P. cellulositrophicus SBT1and Paenibacillus sp. SBT8 roughly produced as much as 18.6 mg/l and 24.8 mg/l of extracellular cellulases,respectively. Enzymatic assay showed that SBT1 and SBT8 cellulase exhibited enzymatic acitivity of 0.17 U/mg and 0.12 U/mg, respectively. Temperature dependencies analysis indicated that both cellulases exhibitedmaximum activity at 35oC. At the temperature higher than 55oC, the enzymatic activities of both cellulases wereroughly 20% reduced compared to the maximum activity. SBT1 and SBT8 cellulases were both active at acidicpH. At basic pH (pH 8) the enzymatic activities of both cellulases were reduced roughly 30% compared to thatof acidic pH. Supplementing of Mg2+, Zn2+, and Ca2+ in range of 1-10 mM increased the enzymatic activity ofboth cellulases roughly 33 to 50%.
The effect of ethanolic extract of black and white rice bran (Oryza sativa L.) on cancer cells Rizal Maarif Rukmana; Nyoman Puniawati Soesilo; Rumiyati Rumiyati; Rarastoeti Pratiwi
Indonesian Journal of Biotechnology Vol 21, No 1 (2016)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1157.736 KB) | DOI: 10.22146/ijbiotech.26814

Abstract

Indonesia has a wide range of rice cultivars and pigments. This rice can be used as a source of phytochemical compounds for cancer prevention. This research aims to analyze the cytotoxic activities of the ethanolic extract of black rice bran of 4 local cultivars i.e. ‘Cempo Ireng’, ‘Woja Laka’, ‘Toraja’ and ‘IR­64’ (white rice) on  cancer cells and to determine the compounds groups of those extracts. First step, rice bran was extracted with ethanol. This extract was applied to Raji (a human Burkitt Lymphoma cancer), HepG2 (a human liver cancer), and Vero (a nonhuman cell line) cells in order to measure the cytotoxic activities by using MTT assay. To determine descriptively the compounds groups of phenolics, flavonoids, terpenoids, steroids, and alkaloids the thin layer chromatography method was performed. The IC50 value was analyzed quantitatively by using probit analysis. Results showed that the IC50 values of ethanolic extract of rice bran ‘Woja Laka’, ‘Toraja’, ‘Cempo Ireng’ and ‘IR 64’ on HepG2 cells were 857.23±99.19; 1,896.55±83,8; 1,494.47±87.81 and 727.89±145,97 µg/ml respectively. The IC50 on Raji cells were 816.61±85.31; 1,079.93±28.31; 1,627.82; ±119.82, and 769.33±61.43 µg/ml respectively. The IC50 on Vero cells were 1,295.2±37; 1,232.07±165.51; 1,874.14±169.56, and 724.4±122.79 µg/ml respectively. The ethanolic extracts of rice bran from four cultivars contain phenolics, flavonoids, terpenoids, and steroids. However, alkaloids could not be detected. The variety of rice cultivars indicates the variation of cytotoxic activities on cancer cells. The ethanolic extracts of rice bran from those four rice cultivars contain similar kinds of organic compounds groups but vary in the Rf values.
Microorganisms Associated with Volatile Organic Compound Production in Spoilt Mango Fruits Aliyu D. Ibrahim; Bankole S. Oyeleke; Ummul Khaltum Muhammad; Adamu Aliyu Aliero; Sabo E. Yakubu; Hadiza M. Safiyanu
Indonesian Journal of Biotechnology Vol 16, No 1 (2011)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (388.484 KB) | DOI: 10.22146/ijbiotech.7831

Abstract

Microorganisms associated with the production of volatile compound in spoilt mango fruits sold in Sokoto town were isolated and identified. The organisms include seven species of bacteria and a species of yeast. These include Bacillus pumilus, Bacillus firmus, Brevibacillus laterosporus, Morganella morganii, Paenibacillus alvei, Staphylococcus saccharolyticus, Listeria monocytogenes and Candida krusei respectively. GC-MS analysis revealed the presence of eleven and sixteen volatile organic compound in the healthy and spoilt ripe mango fruits. Octadecanoic acid, oleic acid, 1 – Butanol, 3 – methyl-, carbonate (2:1) and 3,7 – Dimethyl nonane were common to both healthy and spoilt fruits with the first three having higher concentration in healthy fruits than spoilt while the later had higher concentration in the spoilt. One methyl group of 3,3- Dimethyl hexane in healthy fruit was shifted to position two to yield 2,3-Dimethyl hexane in the spoilt fruits. 2,2-Dimethylbutane, Methyl(methyl-4-deoxy-2,3-di-O-methyl.beta.1-threo-hex-4-enopyranosid) urinate, 3-(4-amino-phenyl)-2-(toluene-4-sulfonylamino)-propionic acid, 2-Methyl-3-heptanone, 3,5-Nonadien-7-yn-2-ol, (E,E), Butanoic acid, 1,1-dimethylethyl ester, 1-methyl-3-beta.phenylethyl-2,4,5-trioxoimidazolidine, Pentanoic acid, 2,2-dimethyl, ethyl ester (Vinyl 2,2-dimethylpentanoate), 4-Methyurazole, 1-Tridecyn- 4 – 9 – ol, 1-Hexyl-1-nitrocyclohexane were unique to spoilt fruits. This study suggests that these unique volatile metabolites could be exploited as biomarkers to discriminate pathogens even when more than one disease is present thereby curbing post harvest loss during storage after further validation and the volatile organic compound could form the basis for constructing a metabolomics database for Nigeria.
Gelatin extraction from the indigenous Pangasius catfish bone using pineapple liquid waste Yoni Atma; Hisworo Ramdhani
Indonesian Journal of Biotechnology Vol 22, No 2 (2017)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1142.533 KB) | DOI: 10.22146/ijbiotech.32472

Abstract

Gelatin extraction from fish bone has traditionally involved hydrogen chloride and/or sodium hydroxide during pre-treatment. However, these chemicals have begun to be abandoned because of their associated safety and environmental issues. Several studies have looked at the use of citric acid as a safer alternative in fish bone gelatin extraction. The aim of this research was to extract gelatin from the bone of Pangasius catfish with pineapple liquid waste. The extraction was performed in two steps: pre-treatment followed by main extraction at various times (24–56 h) and temperatures (45–75°C). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used as a confirmation test and showed a band for gelatin at ~120 kDa. Gelatin yields were calculated as the ratio of weight of dried gelatin to the total weight of fish ossein. The results indicated that pineapple liquid waste can be used for fish bone gelatin extraction. The recommended conditions for extraction of fish bone gelatin using pineapple liquid waste are 56 h of pre-treatment and 5 h of main extraction at a temperature of 75°C. The gelatin yield was 6.12% and the protein concentration 4.00 g/100 g.
Chemosystematic of Enterobacteriaceae Familia Obtained from Blood Cultures Based on Total Protein Profiles Sri Darmawati; Langkah Sembiring; Widya Asmara; Wayan T. Artama; Syaiful Anwar
Indonesian Journal of Biotechnology Vol 18, No 1 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (303.344 KB) | DOI: 10.22146/ijbiotech.7862

Abstract

The purpose of this study was to determine the chemosystematic of 14 strains of bacteria in blood cultures from Semarang using 1 reference strain S. typhi NCTC 786, based on the total protein profi les with the similarity relationship analysis based on Simple Matching Coeffi cient (SSM) analysis and algorithm methodof unweighted pair group with averages (UPGMA) presented in a dendrogram. The results showed that thechemosystematic based on the total protein profi les using SDS-PAGE method can classify the member ofbacterial strains of each species. The Clusters respectively consist of 4 strains of S. typhi (similarity: 89.7%),2 strains of Ser. marcescens (similarity: 89.7%), two strains of E. coli, and one strain of Salmonella ssp, S. typhi NCTC 786 (similarity: 100%). Those three incorporated clusters had the similarity value of 75.3%. Those four strains of Ent. cloacae composed in one cluster (similarity: 100%) are incorporated in a cluster consisting of one strain of Kleb. pneumoniae (similarity: 92.9%). Both clusters were incorporated in a cluster consisting of S. typhi NCTC 786 (similarity: 67.9%). Key words: Enterobacteriaceae, chemosystematic, blood cultures, protein profile
A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis S. Sumartono
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.325 KB) | DOI: 10.22146/ijbiotech.7409

Abstract

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/µl, 52,25 pg/µl, 15,83 pg/µl and 5,225 pg/µl were tested to detect 0,6551 µg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/µl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method.
CYP3A4*1G gene Polymorphism on Javanese People Em Sutrisna; Iwan Dwiprahasto; Erna Kristin
Indonesian Journal of Biotechnology Vol 16, No 2 (2011)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (637.51 KB) | DOI: 10.22146/ijbiotech.16373

Abstract

Most of drugs are metabolized by cytochrome P 450 (CYP) enzyme. Cytochrome P450 3A4 is thecytochrome that is involved in metabolizing more than 60% of all medicine used in human. The variationof this CYP3A4 gene will affect the catalytic activity of this enzyme. Recently, CYP3A4*1G in intron 10 wasfound in Chinese and Japanese population. There is a substitution of G to A at position 82266 in intron 10. Thepurpose of this research was to investigate the frequency of allele and genotype CYP3A4*1G. Samples weretaken from bloods of the subjects of the research. The examination of CYP3A4*1G was conducted by RTLP-PCRmethod.As the results of this research, the frequency of CYP3A4*1G in Javanese people is CYP3A4*1/*1 0.25,CYP3A4*1/*1G 0.55 and CYP3A4*1G/*1G 0.20. Frequency of allele G: 0.53, allele A: 0.47. The Fisher’s exact- testshows that the allele and genotype frequencyis p. 1.000. The allele and genotype frequency of Javanese peopleisstill in Hardy-Weinberg equilibrium.
Isolation and Analysis of DNA Fragment of Genes Related to Kopyor Trait in Coconut Plant S. Sukendah; Hugo Volkaert; S. Sudarsono
Indonesian Journal of Biotechnology Vol 14, No 2 (2009)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (316.744 KB) | DOI: 10.22146/ijbiotech.7814

Abstract

Kopyor coconut is a natural mutant that has abnormal endosperm development. For the first time several genes that were suspected to be related to kopyor trait were identified based on the chemical compounds of the endosperm that different from that of normal coconut. Sucrose synthase (SUS), Stearoyl acyl carrier protein desaturase (SACPD), and Absicid acid insensitive (ABI) genes were isolated and analyzed. Four DNA fragments with length of 746, 738, 780, and 687 bp (CnSus1A, CnSus1B, CnSus2A, and CnSus2B) were obtained from SUS gene. Sequence analysis at DNA and amino acid level showed that CnSus1A, CnSus1B, CnSus2A, and CnSus2B were classified into monocot SUS group with nongrass SUS type. Isolation of SACPD gene resulted in one DNA fragment with DNA length of 716 bp. CnSacpd shared a high homology with SACPD gene of oil palm and soybean. Isolation of ABI gene resulted in two DNA fragments, CnAbi3A and CnAbi3B, with DNA length of 760 and 728 bp, respectively. CnAbi3A and CnAbi3B showed a high homology with ABI3 gene of several plants. All DNA fragment obtained from SUS, SACPD, ABI genes were used as templates to design spesific markers for each corresponding gene. There were 7 specific primer sets designed, i.e., CnSUS1A, CnSUS1B, CnSUS2A, CnSUS2B, CnSACPD, CnABI3A, and CnABI3B.<
Agrobacterium tumefaciens-mediated transformation of Jatropha curcas L. with a polyhydroxyalkanoate gene (phaC) Chesara Novatiano; Adi Pancoro; Erly Marwani
Indonesian Journal of Biotechnology Vol 22, No 2 (2017)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (5129.728 KB) | DOI: 10.22146/ijbiotech.27165

Abstract

Polyhydroxybutyrate is a component of bioplastics that is synthesized under the control of enzymes encoded by pha multigenes. The genes are naturally present in Ralstonia eutropha. However, the production of bioplastics in bacteria is inefficient because the bacterial biomass is relatively small compared with plants or fungi. As such, engineering techniques have been developed that enable pha genes to be inserted into plant biomass, and then be expressed in the biomass of the plant to produce polyhydroxybutyrate. The objectives of this study were to transform the tissue of Jatropha curcas using the phaC gene (a pha gene), to regenerate the transformed plant, and to confirm the presence of the inserted genes with PCR. The genetic transformation of J. curcas was mediated by Agrobacterium tumefaciens strain GV3101 containing pARTC by dipping the cotyledon tissue of J. curcas in a suspension of the bacterium for 30 min, followed by cocultivation for 3 d on Murashige and Skoog (MS) medium. The tissue was then placed on a selection medium, i.e. MS medium containing 13.3 µM BAP and 0.05 µM IBA with the addition of 20 mg/L kanamycin. The results showed that 12.35% of the tissue survived and regenerated into a shoot after 1–2 months. Molecular analysis of the transformed tissue was performed using phaC and nptII primers, in order to detect the presence of the phaC and nptII genes. Specific bands were detected at 659 bp and 700 bp, corresponding to the nptII primer and phaC primer, respectively.
Poly-β-Hydroxybutyrate (PHB) Production By Amylolytic Micrococcus sp. PG1 Isolated From Soil Polluted Arrowroot Starch Waste Sebastian Margino; Erni Martani; Andriessa Prameswara
Indonesian Journal of Biotechnology Vol 19, No 1 (2014)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (287.987 KB) | DOI: 10.22146/ijbiotech.8634

Abstract

Poly-β-hydroxybutyrate (PHB) production from amylolytic Micrococcus sp. PG1. Poly-β-hydroxybutyrate(PHB) is an organic polymer, which synthesized by many bacteria and serves as internal energy. PHB ispotential as future bioplastic but its price is very expensive due to glucose usage in PHB industry. Thedevelopment of PHB production using starch as an alternative carbon source has been conducted to reducethe dependence of glucose in PHB production. In this study, amylolytic bacteria from arrowroot processingsite were screened quantitavely based on amylase specifi c activity and PHB producing ability. The result of thestudy showed that among of 24 amylolytic isolates, 12 isolates of them were able to accumulate PHB rangedfrom 0,68-11,65% (g PHB/g cdw). The highest PHB production from substrate arrowroot starch was PG1 andafter optimization resulted in increasing of PHB production up to 16,8% (g PHB/g cdw) 40 hours incubationtime. Based on morphological, biochemical and physiological characters, the PG1 isolate was identifi ed asMicrococcus sp. PG1. Result of the FTIR analysis of produced polymer by Micrococcus sp. PG1 was indicatedas poly-β- hydroxybutyrate (PHB)

Filter by Year

2005 2026