cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 530 Documents
Production and Extraction Of Antibacterial Bacteriocin from Pediococcus sp. NWD 015 Harmayani, Eni; N, Nofisulastri; Bachruddin, Zaenal
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (147.738 KB)

Abstract

objectives were to study the growth pattern of Pediococcus sp. NWD 015 and bacteriocin activity, extractionand characterization of bacteriocin, and to determine the effect of storage time and temperature on bacteriocinactivity. Results showed that the bacteriocin activity increased during growth and reached the highest activity duringstationary phase. The maximum bacteriocin production reached after incubation of the cell for 12 h at 37oC in TGEbroth and decreased after 96 h incubation. Extraction with adsorbtion-desorbtion method could increased a specificactivity of bacteriocin. Bacteriocin from Pediococcus sp. NWD 015 is inactivated by Proteinase-K; however it is stillactive by heat treatment at 121oC for 15 min and over pH 2 – 11. Bacteriocin of Pediococcus sp. NWD 015 was effectiveagaints Enterococcus faecalis, Staphylococcus aureus, Eschericia coli, Listeria monocytogenes but not against Salmonellathypimurium. The molecular weight of bacteriocin is 4.95 kDa.Keywords : Bacteriocins, Pediococcus sp NWD 015.
Citrus reticulata’s Peels Modulate Blood Cholesterol Profile and IncreaseBone Density of Ovariectomized Rats Adelina, Rosa; Supriyati, Maria Dwi; Nawangsari, Dwi Ana; Jenie, Riris I; Meiyanto, Edy
Indonesian Journal of Biotechnology Vol 13, No 2 (2008)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (120.764 KB)

Abstract

Hormon Replacement Therapy is a common therapy for estrogen deficiency but in other side it will increase the risk of cardiovascular disease. Another alternative therapy which relatively more safe is using phytoestrogen. The Citrus reticulata’s peel contain flavanone and polimethoxyflavone which are suspected to give estrogenic effect, therefore it is potential to be used as phytoestrogen.The purpose of this study was to examine the estrogenic effect of Citrus reticulata’s peel extract in modulation of bone density and blood cholesterol profile of ovariectomized rats (OVX), an animal model of postmenopausal osteoporosis. Thirty six 7-weeks-old female Sprague Dawley rats were assigned to six groups: a SO group, an OVX group, an OVX+CMCNa group, an OVX+extract dose 500 mg/kgBW group, an OVX+extract dose 1000 mg/kgBW group, and an OVX+estradiol group. After 7 weeks, the rats were killed then blood and femoral were collected immediately. The rontgenogram indicated that extract and estradiol administration increase the bone density. And the data analysis with Oneway ANOVA test ,followed by Shceffé test (P 0.05) showed that extract can improve blood cholesterol profile in dose depend manner. These results suggest a possible role of Citrus reticulata’s peel extract as women’s health agent because of its beneficial effects on bone and lipids.
Effect of Substrate Concentration to Anode Chamber Performance in Microbial Electrolysis Cell Darus, Libertus
Indonesian Journal of Biotechnology Vol 16, No 1 (2011)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (796.268 KB)

Abstract

Microbial electrolysis is a promising process for bio-hydrogen production which might be implemented in waste water treatment in a near future. Unfortunately substrate could be converted into methane by acetoclastic methanogens and will reduce the coulombic efficiency (CE). The research objective was to study the competition between electrogens and methanogens for substrate in a continuous Microbial Electrolysis Cell (MEC).The competition was studied in relation to controlling acetate influent concentration (Cin) from 35 to 1 mM with a fixed anode potential -350 mV, by assessing activity of electrogens as current density (CD), activity of acetoclastic methanogens as methanogenic consumed acetate (Cmeth), and CE and by measuring anolyte protein content to confirm a steady state condition. Controlling Cin from 35 to 1 mM resulted in tendency of both CD and Cmeth to decrease and CE to increase. At decreasing Cin from 35 to 5 mM which left excess acetate concentration in anolyte, the CEs were between 36.4% and 75.3%. At further decreasing Cin to 1 mM the acetate concentration was limited (Cef 0 mM), but the CE only reached 95.8%. Methanogenesis always occur and electrogens were not able to outcompete the acetoclastic methanogens even though the substrate concentration was limited.Keywords : microbial electrolysis cell, bio-hydrogen, metanogenesis, substrate concentration
A Novel Variant of HOXA10 gene, Ser19Cys, among Patients with Endometriosis and its Relationship with the Severity of the Disease Hutajulu, Pinda; Dasuki, Djaswadi; Sadewa, Ahmad Hamim; Utoro, Totok
Indonesian Journal of Biotechnology Vol 18, No 1 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (186.502 KB)

Abstract

Endometriosis is a gynecological disease associated with inherited genetic traits. HOXA10 gene whichis expressed in uterine plays an important role in the pathogenesis of endometriosis. The protein affects thedevelopment of pinopodes as a biomarker of endometrial receptivity in endometriosis.The aim of this study isto examine if there is a mutation or polymorphism within HOXA10 gene among patients with endometriosis.Thirty twopatients and 32 healthy women were recruited as subjects of this study. The exon 2 of HOXA10which covers most of coding region was amplifi ed using PCR. The presence of a mutation or polymorphismwas detected by direct seguencing. The distribution of genotype and allele was analyzed using Chi square test with p<0.05 is considered as signifi cantly different. A novel heterozygous variant within exon 2 of HOXA10 which substitute an adenine into thymine was detected at base position 55. This missense alteration changed amino acid serine to cystein (Ser19Cys). Interestingly, this variant was detected in 12 endometriosis cases (38%) but none in control. Patients carry HOXA10 Ser19Cys variant were associated with dismenorea and more frequent in stage I endometriosis. The role of this variant in the function of HOXA10 protein and frequency among Indonesians need to be clarifi ed. We found a novel heterozygous HOXA10 gene variant, Ser19Cys.The genotype frequency is 38% among endometriosis patients but none in control. This variant found in patient with dismenore and endometriosis stage 1.Key words: HOXA10 gene, endometriosis, Ser19Cys polymophism
Nuclear Import Analysis of Two Different Fluorescent Marker Proteins into Hepatocyte Cell Lines (HuH-7 Cell) Haryanto, Aris; Kann, Michael
Indonesian Journal of Biotechnology Vol 10, No 2 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (156.459 KB)

Abstract

The application of fluorescent proteins as expression markers and protein fusion partners has provedimmensely valuable for resolving the organization of biological events in living cells. EGFP and DsRed2 arecommonly fluorescent marker protein which is used for biotechnology and cell biology research. The presentstudy was designed to identify the expression vector that suitable to ligate with DNA encoding HBV coreprotein for intracellular localization study in hepatocyte cell, which were expressed as fusion proteins. We alsocompared and quantified the expressed fluorescent protein which predominantly localized in the cellcompartment. The results indicated that DsRed2 shown as less than ideal for intracellular localization study ofthan EGFP, because of its tetrameric structure of the fluorescent protein and when fused to a protein of interest,the fusion protein often forms aggregates in the living cells. In contrast, EGFP fluorescent protein shown a muchhigher proportion of cytoplasmic localization, thus being more suitable for analysis of intracellular localizationthan DsRed2 fluorescent protein. EGFP fluorescent protein is also capable to produce a strong green fluorescencewhen excited by blue light, without any exogenously added substrate or cofactor, events inside living cell canthus be visualized in a non-invasive way. Based on our present quantitative data and some reasons above shownthat EGFP is more suitable than DsRed2 as a fluorescent marker protein for intracellular localization study intoHuH-7 cell.Keywords: EGFP, DsRed2 fluorescent protein , HuH-7 cell, HBV, intracellular localization
Effect of Nuclear Export Inhibitor Leptomycin B on the Intracellular Localization of HBV Core Protein into Hepatocytes Cell Line Huh-7 and HepG2 Cells Haryanto, Aris; Wijayanti, Nastiti; Kann, Michael
Indonesian Journal of Biotechnology Vol 15, No 2 (2010)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (187.836 KB)

Abstract

Leptomycin B (LMB) was originally discovered as a potent anti-fungal antibiotic from Streptomyces species. The cellular target of LMB has been identified as the nuclear export receptor CRM-1 or exportin-1, which is involved in nuclear trafficking of cellular RNAs or proteins containing the nuclear export sequence (NES). CRM-1 is the main mediator of nuclear export in many cell types including hepatocyte cell lines. The ability of LMB to inhibit nuclear export has made it a useful tool in the study of the intracellular localization of manyregulatory proteins. In this study, we evaluated the effect of nuclear export inhibitor LMB treatment on the intracellular localization of HBV core protein into the hepatocyte cell lines, Huh-7 and HepG2 cells. We also reported the quantification of the distribution of EGFP-Core fusion protein with redundant core NLS as well as SV-40 NLS into cell compartments. Results shown that in Huh-7 cells treatment of LMB caused retention of EGFP-Core fusion protein into the nucleus, so increased the nuclear localization of EGFP-Core and all variants.In HepG2 cells, although not significantly, treatment of LMB increased a number of nuclear localization in all EGFP-Core constructions, even the nuclear localization in HepG2 cells is not so high as in Huh-7 cells. Keywords: Leptomycin B, HBV, core protein, intracellular localization, NLS, Huh-7, HepG2 cell
Genetic Relatedness among Duku, Kokosan, and Pisitan in Indonesia Based on Random Amplified Polymorphic DNA Markers Hanum, Laila; Kasiamdari, Rina Sri; ., Santosa; ., Rugayah
Indonesian Journal of Biotechnology Vol 17, No 2 (2012)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (306.302 KB)

Abstract

Genetic relatedness among duku, kokosan, and pisitan from Indonesia were investigated using random amplified polymorphic DNA (RAPD) markers. Eleven primers (OPA-01, OPA-02, OPA-10, OPB-07, OPB-11, OPB-12, OPB-15, OPT-16, OPU-14, OPU-19, and OPU-20) were used for amplification and yielded a total of 174 DNA bands, of which 167 were polymorphic. Primer OPA-10, OPB-11, OPB-12, OPB-15, and OPU-19 produced all of the polymorphic DNA bands. The size of the amplified DNA fragments ranged from 41-1546 bp. The dendrogram separated into two clusters at a genetic similarity coefficient of 0.76. The cluster 1 consisted of subclusters duku and several pisitan (pisitan OKI, pisitan Sleman, pisitan Hatu, pisitan Punggur, and pisitan Tanjung), and cluster 2 consisted of subclusters kokosan and pisitan. In the kokosan subclusters, including duku Drendan. Dendrogram supported the determination of taxonomic status of duku, kokosan, and pisitan as one species, namely Lansium domesticum Corr. and its divided into two groups, namely L. domesticum ’duku group’ and L. domesticum ’pisitan-kokosan group’. Thus, RAPD analysis was useful tool for determining the genetic variation and the genetics relatedness among duku, kokosan, and pisitan in Indonesia.Key words: duku, kokosan, pisitan/langsat, genetic relatedness, RAPD
A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis S, Sumartono
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.325 KB)

Abstract

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecularprobe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genomeand a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probelabeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with themolecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detectionstarter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequenceGGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNAtarget by dot blot method.Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization
Impact of Curcuma mangga Val. Rhizome Essential Oil to p53, Bcl-2, H-Ras and Caspase-9 expression of Myeloma Cell Line Astuti, Endang; Sunarminingsih, Retno; Jenie, Umar Anggara; Mubarika, Sofia; S, Sismindari
Indonesian Journal of Biotechnology Vol 19, No 1 (2014)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (492.993 KB)

Abstract

Cancer is a disease, a public health problem, which is found in the world as well as in Indonesia. Ingeneral, some of cancer theraphies are ineffective, characterized by the resistance performance of cancer cell line,the exposed normal cell and by the side effects. Nowadays, studies to fi nd the specifi c and safely anti-cancerdrugs were increased by the time. Several studies revealed that Curcuma mangga Val. Rhizome contains somesecondary metabolites, essential or non-essential oil, which has cytotoxic activities to the cancer cells. Basedon these anti-cancer potentials, this study has several aims to recognize anti-cancer selectivity and molecularmechanism by inducting apoptosis and inhibiting myeloma cell proliferation. To C. mangga Val. essential oil,immunocyto chemical test was performed to determine the expression of p53, caspase-9, Bcl-2, H-Ras proteinwhile TUNEL test was performed to determine the number of apoptosis cells.The results of this study shown that anti-cancer molecular mechanism of C. mangga Val. essential oil tomyeloma cell line was performed by increasing apoptosis; by increasing the expression of pro-apoptosis p53,caspase-9 protein and reducing protein which is increasing proliferation Bcl-2 and H-Ras.
Effect of the HBV Capsid Assembly Inhibitor Bayer 41-4109 on the Intracellular Localization of EGFP-Core Fusion Proteins Haryanto, Aris; Wijayanti, Nastiti; Kann, Michael
Indonesian Journal of Biotechnology Vol 12, No 2 (2007)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (219.917 KB)

Abstract

Bayer 41-4109 is heteroarylpyrimidine (HAP) which has been identified as potent of HBV capsid assemblyinhibitor. The present study was to study effect of Bayer 41-4109 treatment on the intracellular localization ofEGFP-Core fusion proteins into HepG2 cells. Three recombinant plasmids of pEGFP-Core with single, double andtriple NLS of HBV core (EGFP-Core 1C, 2C and 3C ) and two recombinant plasmids with single and triple NLS ofSV-40 (EGFP-Core 1 and 3 SV-40) were used in this work. After transient transfected into HepG2 cells and treatedwith Bayer 41-4109, the intracellular localization of expressed fusion proteins from all plasmid constructions weredetermined and quantified under confocal laser microscope. Results shown that Bayer 41-4109 treatment in HepG2cells inhibited the nuclear localization of EGFP-Core with single of triple HBV core NLS. As well as the constructionsof expressed fusion protein with single and triple SV-40 NLS (EGFP-Core 1 and 3 SV-40 NLS) showeddecreasing the nuclear localization after treated with Bayer 41-4109, even not as strong as EGFP-Core 1C and 3CNLS. Bayer 41-4109 has been identified as a potent inhibitors of HBV replication which has multiple effects on HBVcapsid assembly. It may inhibit virus replication by inducing assembly inappropriately and by misdirectingassembly decreasing the stability of normal capsids.Keywords: HBV capsid, Bayer 41-4109, EGFP-Core fusion protein, HepG2 cell

Page 4 of 53 | Total Record : 530


Filter by Year

2005 2026