cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 537 Documents
Functional Analysis of OsKANADI1, A Florigen Hd3a Interacting Protein in Rice (Oryza sativa L.) Purwestri, Yekti Asih; Ogaki, Yuka; Tsuji, Hiroyuki; Shimamoto, Ko
Indonesian Journal of Biotechnology Vol 17, No 2 (2012)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (249.281 KB)

Abstract

OsKANADI1 is considered as a florigen Hd3a interacting protein. To study the function of OsKANADI1, the expression pattern of OsKANADI1 was performed by semiquantitative RT-PCR with various wild-type tissues in the floral transition stage. The results demonstrated that OsKANADI1 was expressed in all organs of wild-type plants, but was highest in roots and leaves. We hypothesize that OsKANADI1 is a transcription factor in rice because it contains a GARP domain and posses a nuclear localization signal. To determine whether OsKANADI1 encodes a nuclear protein, full-length OsKANADI1 fused to GFP was introduced into onion epidermis cells by particle bombardment. The result revealed that OsKANADI1 was localized in the nucleus, suggesting that OsKANADI1 may be a transcription factor. Functional analysis was carried out using a reverse genetics approach to generate gain of function mutant (overexpression) and knockdown mutant (RNAi). The results showed that suppression of OsKANADI1 by RNAi displayed branching and increasing tiller number in several lines. This phenotype resembles to the Hd3a overexpressed plants indicating they possibly function in similar pathway.Key words : OsKANADI1, Transcription factor, Hd3a interacting protein, Rice
Relationship between Nucleus Swelling and Development Competence of Bovine Cloned Embryos Reconstructed by Enucleated Oocytes with Serum-starved or Serum-fed Fetal Somatic Cells Fahrudin, Mokhamad; Karja, Ni Wayan Kurniani; Suzuki, Tatsuyuki
Indonesian Journal of Biotechnology Vol 10, No 2 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (155.341 KB)

Abstract

This study was conducted to examine the occurrence of nuclear remodeling (nucleus swelling) and its effectson the subsequent in vitro development of bovine embryos reconstructed by serum-starved and serum-fed somaticcells. Results from this study demonstrated that all of the reconstructed embryos that received serum-starved andserum-fed somatic cells exhibited condensed-nuclei. More than 90% of the transferred nuclei exhibited nuclearenvelope breakdown and premature chromatin condensation which clearly distinct from an intact nucleus. Therewas no significant difference on the degree of nucleus swelling in SS-NT embryos or SF-NT embryos, indicatingthat either serum-starved or confluent somatic cell lines could be reprogrammed by the recipient cytoplasmenvironments in similar pattern. Although the fusion rate was not significantly different among the groups, theproportion of SS-NT embryos which developed to the 2- to 4-cell stage (89.7%) and to the 8- to 16-cell stage (74.7%)was significantly higher than that of SF-NT embryos. Whereas, the proportion of reconstructed embryos thatdeveloped to the morula and blastocyst stages were not significantly different among the groups. Results of thesestudies demonstrate that reconstructed embryos, which received either serum-starved or serum-fed confluentsomatic cells, showed similar developmental competence to the blastocyst stage.Keywords: nuclear transplantation technique-somatic cells-nucleus swelling
Characterization of envelope-transmembrane Gene of Jembrana Disease Virus Tabanan 1995 Isolate Kusumawati, Asmarani; Pratiwi, Rarastoeti; Astuti, Pudji; Hamid, Penny Humaidah
Indonesian Journal of Biotechnology Vol 15, No 1 (2010)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (299.935 KB)

Abstract

The availability of specific and rapid detection methods is essential for monitoring the health status of farmed species, particularly in viral disease as in this case early diagnosis is a critical factor in containing disease outbreaks. Jembrana Disease Virus (JDV) is a lentivirus that causes an acute, severe disease syndrome in infected Bali cattle in Indonesia, resulting in heavy economic losses because of the high mortalities. The virus-host interaction and the modes of transmission are still unknown. The goal of the research was to designa probe candidate of Jembrana Disease Virus based on envelope-transmembrane (env-tm) gene to optimize Jembrana disease detection method. The DNA fragment derived from env-tm of JDV was used, cloned in pGEX-TM and expressed in E.coli DH 5α. Sequence analysis was conducted with BLAST programs from NCBI. Sequence analyses of the fragments of env-tm clone, indicated that it has a very closed genetic relation with 97,68% homology identity. Probe was designed based on the conserved region of env-tm using Geneious resulted in JT2 252 bp long. BLAST analyses showed that probes had high specifity to other strains of JDV in Indonesia.Key words : probe, env-tm, JDV, specifity, sensitivity.
Isolation and Purifi cation of Chitinase Bacillus sp. D2 Isolated from Potato Rhizosfer Margino, Sebastian; Behar, Chatarina; Asmara, Widya
Indonesian Journal of Biotechnology Vol 17, No 1 (2012)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (270.988 KB)

Abstract

Potato Cyst Nematodes (Globodera rostochiensis) is one of the important potato’s pests and caused economic looses up to 70% in the several centrals of potato plantations in Indonesia. Potato Cyst Nematodes (PCN) shell component of egg shell containing chitin (inner layer) and vitelline/protein (outer layer), so the purpose of research was to fi nd out of chitin degrading bacteria for controlling of egg’s PCN by cutting of their life cycle. The results showed that Bacillus sp. D2 isolated from potato rhizosphere could produce extra cellular chitinase in the medium containing of 0.20% colloidal chitin and fermented for 72 hours. Result of chitinase purifi cation using ammonium sulphate precipitation and DEAE-Cellulose ion-exchange chromatography showed a specifi c activity 2691,052 U/mg and analyzing using SDS-PAGE 12.5% resulted in molecular weight 30 kDa. The apparent Km and Vmax of chitinase towards colloidal chitin were 2 mg/ml and 2.2 μg/h, respectively.  
Phylogenetic relationship of Gram Negative Bacteria of Enterobacteriaceae Family in the Positive Widal Blood Cultures based on 16S rRNA Gene Sequences Darmawati, Sri; Sembiring, Langkah; Asmara, Widya; Artama, Wayan T.; Kawaichi, Masashi
Indonesian Journal of Biotechnology Vol 19, No 1 (2014)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (431.864 KB)

Abstract

The purpose of this study was to analyze the phylogenetic relationship of Gram negative bacteria (3strains of Salmonella typhi, 1 strain of Escherichia coli, 1 strain of Serratia marcescens, and 3 strains of Enterobactercloacae) of Enterobacteriaceae family in positive Widal blood cultures based on 16S rRNA gene sequences. Theresults respectively showed that each two 16S rRNA gene clones of Serratia marcescens KD 08.4 had a closerelationship with 16S rRNA gene of Serrratia marcescens ATCC 13880 (similarity: 99.53-99.8%), Eschericia coliBA 30.1 with Eschericia coli ATCC 11775T (similarity: 99.38-99.67%), Salmonella typhi BA 07.4, Salmonella typhiKD 30.4, and Salmonella typhi SA 02.2 with Salmonella typhi ATCC 19430T (similarity: 99.4-100%) as well as theisolates of Enterobacter cloacae SA 02.1, Enterobacter cloacae BA 45.4.1, one 16S rRNA gene clone of Enterobactercloacae TG 03.5 with Enterobacter cloacae ATCC 23373 (similarity: 99.0-99.87%).
Phenotype of Transgenic Tobacco Plants (Nicotiana tabacum cv. Petit Havana SR-1) Expressing 1724orf13 Gene of Agrobacterium rhizogenes strain MAFF301724 Nur Handayani, Niken Satuti; Tanaka, Nobukazu; Yoshida, Kazuo
Indonesian Journal of Biotechnology Vol 12, No 2 (2007)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (128.365 KB)

Abstract

Nicotiana tabacum cv. Petit Havana SR-1 transgenic plants expressing ORF13 of Agrobacterium rhizogenes strainMAFF301724 under different promoters displayed plant morphology abnormalities. They were small, with shortand variable internodes lengths; leaves were small, asymmetric, rounded, wrinkled and dark green; flowers wereshort, and irregularly shaped. This phenotype was also exhibited, similar, but not completely the same, to those ofhairy root syndrome, indicating that expression of ORF13 influences plant development.Keywords: ORF13, Agrobacterium rhizogenes strain MAFF301724, transgenic plants, morphology abnormalities
Combination PT-PCR with in vitro Transcription-Translation System: Rapid and Simple Approach for Monoclonal Antibody Production Ali, Muhamad
Indonesian Journal of Biotechnology Vol 14, No 2 (2009)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (428.952 KB)

Abstract

We have developed a simple and efficient system for screening and generation of monoclonal antibodies, which can bypass conventional monoclonal antibody production system that includes time-consuming, labor-intensive establishment and cultivation. Our method consist of: (1) cDNA synthesis from single B cells of immunized mouse, followed by (ii) PCR amplification of the Lc and Hc (Fd portion) cDNAs separately using low concentration (0,05 ìM) of the respective cDNA-specific primers with 5’ homotags in the presence of the homotag-specific primer (0,5 ìM), (iii) overlapping PCR of the amplified Lc and Hc cDNAs with the cassettes for the T7 promoter (T7P) and T7 terminator (T7T) to construct the following expression units: T7P-Lc-T7T and T7P-Hc-T7T, and (iv) in vitro expression of these units using an Escherichia coli S30 extract followed by ELISA screening without</div><div>purification. Light-and heavy-chain cDNA were amplified and expressed using in vitro system, thus avoiding time consuming steps of cloning and bacterial expression. Having successfully amplified and expressed Lc and Hc genes from single B cells in rapid, simple, versatile, labor-saving, and cost effective, this method seem to be useful</div><div>and applicable for the high-throughput monoclonal antibody generation. 
Ability of Curcuminoid from Curcuma domestica Val. in Reducing the Secretion of Reactive Oxygen Intermediates by Synovial Fluid Monocytes in Patients with Osteoarthritis Kertia, Nyoman; Asdie, Ahmad Husain; Rochmah, Wasilah; -, Marsetyawan
Indonesian Journal of Biotechnology Vol 16, No 2 (2011)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (43.035 KB)

Abstract

AbstractIncreasing the secretion of reactive oxygen intermediates (ROI) by monocytes in the synovial fluid is anindicator to determine the severity of joint inflammation. Previous studies have shown that curcumin inhibitthe osteoarthritis progression with its ability to inhibite the activity of the nitric oxide synthase (NOS) enzymefrom macrophages. In this prospective randomized open end blinded evaluations = PROBE study, 80 patientswith knee osteoarthritis were eligable. The subject were devided in to two group: group who received 3 x 30mg of curcuminoid from Curcuma domestica Val. extract (curcuminoid group) and group who received 3 x 25mg of diclofenac sodium (diclofenac group) as comparison. The treatment was for 4 weeks time. The secretionof ROI by sinovial fluid monocytes was calculated by scoring the amount of formazan formation after neutralred staining in nitrobleu tetrazolium reduction assay. The result of this study showed that the secretion of ROIby synovial fluid monocytes was significantly decreased in both groups (p <0.001) respectively. There wasno significant difference in decreasing of ROI secretion of synovial fluid monocytes between both treatmentgroups (p = 0.92).Keywords : curcuminoid, diclofenac sodium, reactive oxygen intermediates, monocyte, osteoarthritis
Comparative Analysis of Genes Induced by Respiratory Syncytial Virus and DsRNA in Human Epithelial Cells Limmon, Gino Valentino
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (479.473 KB)

Abstract

Epithelial cells are the primary target of respiratory viral infections and play a pivotal role in virusinducedlung infl ammation and in anti viral immune response. A common signal for the presence of viralinfections and induction of infl ammation is recognition of double stranded RNA (dsRNA). Thus far, therehas not been a high-throughput transcrptome analysis of RSV- or dsRNA-induced genes in primary humanbronchial epithelial cells (PHBE), nor there has been a comparison between dsRNA- and RSV-inducedgenes. To establish the transcriptome profi les and to determine the contribution of dsRNA in the inductionof infl ammation during respiratory virus infection, we compared the gene expression profi les of PHBE cellsthat were infected with Respiratory Syncytial Virus (RSV) or were treated with dsRNA. Our transcriptomeanalysis showed that RSV infection and and dsRNA treatment induced up-regulation of 2024 and 159 genesin PHBE respectively. Comparison of genes revealed that RSV and dsRNA commonly induced 75 genes inPHBE cells. The common up-regulated genes were functionally grouped in multiple response pathwaysinvolved in infl ammation and immune responses. Interestingly, there were several previously unreportedgenes that were up-regulated in primary human epithelial cells that are relevant to a TH2 allergic phenotype.This comparison of a high-throughput gene expression study offers a comprehensive view of transcriptionalchanges induced by dsRNA and RSV, and importantly compares dsRNA-induced genes with RSV-inducedgenes in PHBE cells.Keywords: RSV, dsRNA, transcriptome, immune response, infl ammation
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.

Page 6 of 54 | Total Record : 537


Filter by Year

2005 2026