cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Indonesian Journal of Biotechnology
ISSN : 08538654     EISSN : 20892241     DOI : -
Core Subject : Science,
The Indonesian Journal of Biotechnology (IJBiotech) is an open access, peer-reviewed, multidisciplinary journal dedicated to the publication of novel research in all aspects of biotechnology, with particular attention paid to the exploration and development of natural products derived from tropical—and especially Indonesian—biodiversity. IJBiotech is published biannually and accepts original research articles featuring well-designed studies with clearly analyzed and logically interpreted results. A strong preference is given to research that has the potential to make significant contributions to both the field of biotechnology and society in general.
Arjuna Subject : -
Articles 537 Documents
Metagenomic analysis of bacterial diversity in pigeon pea after soaking in water
Indonesian Journal of Biotechnology Vol 29, No 3 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.94293

Abstract

This study investigated the diversity of bacterial community in the samples of pigeon pea (Cajanus cajan L. Millsp.) soaked in water for 12 h and 24 h. The detection of certain bacterial species in the samples that can be isolated and potentially be used as starter cultures in the development of pigeon pea‐based functional foods is the importance of this study. For bacterial identification, the V1–V9 regions on the 16S ribosomal RNA gene were amplified using 27F and 1492R primers under specific polymerase chain reaction conditions. Genomic DNA (130 ng) was sequenced on the R9.4 flow cell by Oxford Nanopore Technologies using a GridION sequencer. Library preparations were conducted using a Native Barcoding Kit 24 V14 (SQK‐NBD114.24). Primary data were acquired using MinKNOW version 22.05.7. A total of 13 bacterial families and 89 genera were identified in the pigeon pea sample soaked for 12 h, and 26 families and 90 genera were identified in the pigeon pea soaked for 24 h. The values of five diversity indices showed that the sample soaked in water for 24 h had richer bacterial abundance and diversity than for 12 h. Shannon and Simpson values revealed the higher bacterial diversity in the samples collected at 24 h than in those collected at 12 h. Species observation and abundance‐based coverage estimators (ACE) values demonstrated that the samples collected at 24 h harbored higher bac‐ terial richness than those collected at 12 h. Bacterial communities during soaking of the pigeon pea were dominated by the family Enterobacteriaceae and genus Enterobacter. The presence of bacterial genera like Lacticaseibacillus, Lentilactobacillus, and Secundilactobacillus is interesting because of their importance as starter cultures for fermented plant‐based milk products
Antimicrobial compounds from intracellular and extracellular secondary metabolites of Actinobacteria InaCC A759 Maya Dian Rakhmawatie; Mustofa Mustofa; Puspita Lisdiyanti; Tri Wibawa; Kanti Ratnaningrum; Muhammad Mucharom Chairul Umam; Muhammad Hasan Alfi; Listya Chariri
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.82376

Abstract

The World Health Organization (WHO) has determined a list of pathogens that require the development of new antimicrobials due to resistance problems; these include Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus aureus. In addition, Mycobacterium smegmatis has been used for antimycobacterial discovery to address the increasing burden of tuberculosis. In this study, optimization of antimicrobial activity, secondary metabolite profiling, and strain identification was conducted on Actinobacteria InaCC A759. Intracellular and extracellular extracts of Actinobacteria InaCC A759 were found to have different antimicrobial activities. The minimum inhibitory concentration (MIC) values of the extract to inhibit the growth of M. smegmatis, E. coli, and P. aeruginosa were 50, 25, and 100 µg/mL (intracellular), and 25, 25, and 100 µg/mL (extracellular), respectively. However, neither extract was able to inhibit the growth of S. aureus. Metabolite profiling using High resolution‐mass spectrometry (HR‐MS) resulted in differences in the major compound between the two extracts of Actinobacteria InaCC A759, namely n‐acetyltyramine (C10H13NO2/179.0945) (24.24%) (intracellular) and palmitic acid (C16H32O2/273.27034) (86.92%) (extracellular). Based on molecular analysis of the 16S rRNA gene, Actinobacteria InaCC A759 is identical to the Streptomyces olivaceus strain FoRh46. The antimicrobial activity and secondary metabolites profiles of Streptomyces olivaceus InaCC A759 have not been previously reported.
Antidiabetic activity of Averrhoa bilimbi fruit methanol extract through enhancement of GLUT4 protein expression in diabetes‐induced mice Greselita Yolanda Juniyanti; Hesti Oktapiani; Ahmad Ridwan
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.83839

Abstract

GLUT4, the glucose transporter responsive to insulin, is primarily found in muscle and adipose tissues. Diabetes can result from impaired insulin secretion and sensitivity. This study aims to evaluate the antidiabetic properties of Averrhoa bilimbi methanol extract by enhancing GLUT4 protein expression in mice with induced diabetes. Extraction was conducted via soxhletation using 96% methanol. Phytochemical analysis, employing qualitative tests and GC‐MS, was performed. Antioxidant activity (IC50) and toxicity (LD50) were analyzed using DPPH and OECD methods. This research followed an experimental post‐only control group design, with mice intraperitoneally injected with 150 mg/kg BW of alloxan monohydrate. A total of 24 mice were then divided into six groups: Normal, Negative Control, Positive Control (metformin), Low Dose (50 mg/kg BW), Medium Dose (250 mg/kg BW), and High Dose (300 mg/kg BW). Treatment lasted 21 days, with fasting blood glucose and body weight measurements taken every three days. On day 21, the liver and skeletal muscle were isolated, and blood was collected. Serum insulin and GLUT4 expression were assessed via ELISA and Western Blot, respectively. Phytochemical screening revealed flavonoids, saponins, terpenoids, tannins, and phenols and their derivatives. The IC50 value was 85 µg/mL, with an LD50 value of 1,000 mg/kg BW, indicating strong antioxidant activity and mild toxicity. The extract significantly reduced blood glucose levels but did not impact weight loss in diabetic mice. Average liver weight and index were highest in the Negative Control group, yet the lowest levels of hepatic and muscle glycogen were also observed in this group. Interestingly, insulin level and HOMA‐IR decreased in diabetic mice, while the Medium Dose group exhibited the highest GLUT4 expression levels. In conclusion, medium doses of A. bilimbi methanol extract hold potential for diabetes treatment, with a probable mechanism of targeting GLUT4 protein expression.
Morphology and molecular characterization of Vanda tricolor × Vanda limbata orchid hybrid based on VOH1 gene characters Alydarafa, Hafshah; Melati, Chrisnanda Ayu; Semiarti, Endang
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.91456

Abstract

Vanda is a monopodial epiphyte orchid that spreads throughout Asia and Southeast Asia reaching 70 species. Indonesia itself has its own endemic Vanda orchid such as Vanda tricolor and Vanda limbata. A hybrid of V. tricolor and V. limbata is predicted to form a new specific character in the flower and leaf. The purpose of this study was to determine the morphological and molecular differences between V. tricolor, V. limbata, and Vanda hybrids resulting from crosses between that two orchids, by analysing the morphological characteristics of the roots, leaves, flowers and the structure of the Vanda Orchid Homeobox1 (VOH1) shoot‐forming gene isolated from V. tricolor, V. limbata, and their hybrids. The morphological analysis was conducted using RHS colour chart, size measurement of plants, and the transversal preparation of the leaf. Molecular analysis was performed by PCR using Dendrobium Orchid Homeobox 1 (DOH1) primers, followed by sequencing and bioinformatic analysis. Morphologically, the flower’s colour of the hybrid is most similar to V. limbata but the flower’s patterns are more similar to V. tricolor meanwhile the leaf colour of the hybrid is brighter than the both parents. The slides illustrate the sclerenchyma tissue is made up of strongly thickened walls containing lignin indicates the presence of homeobox DOH1 gene homolog, namely VOH1. The molecular result displayed by the phylogenetic tree of the VOH1 indicates that the hybrid has more similarities with V. limbata.
Development of nanocomplex mimic‐hsa‐miR‐143‐3p loaded exosome (exo‐miR) to inhibit viability, migration and proliferation of triple‐negative breast cancer Nilasari, Fita; Haryana, Sofia Mubarika; Nugrahaningsih, Dwi Aris Agung; Satriyo, Pamungkas Bagus
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.92817

Abstract

Breast cancer represents the highest number of cancer cases in Indonesia, with triple‐negative breast cancer (TNBC) being a common subtype (10–15%). MicroRNAs play a role in cancer epigenetics and contributing as core factors to the disease. The expression of miR‐143‐3p have been found to be lower in breast cancer samples from Yogyakarta and Central Java. It is known that miR‐143‐3p functions as a tumor suppressor in breast cancer, and its overexpression corresponds with an increased survival rate. The structure of miRNA is quickly degraded, an enhanced delivery system for miRNA is required. Exosomes are indeed emerging as natural delivery agent. A new approach represents that exosomes will be transfected with mimic‐hsa‐miR‐143‐3p yield an exo‐miR. The research aimed to examine how exo‐miR affects viability, migration, and proliferation using 4T1 cell line. The Exo‐Fect‐based method was used to transfect mimic‐hsa‐miR‐143‐3p into exosomes. The MTT assay, wound healing assay, and colony formation assay were used as functional assay. The MTT assay revealed that 7.5 µL/ 250,000 particles exo‐miR obtained a lower percentage of cell viability (58%) than the control (99.7%). The wound healing assay showed that transfection of 37.5 µL/ 1,250,000 particles exo‐miR was able to suppress migration by the percentage of wound closure (67%) compared to the control (100%). Exo‐miR also had a significant (p < 0.001) effect on colony‐forming abilities, as shown by fewer colonies (32) compared to the control (132). This findings demonstrated that exo‐miR represents a promising targeted approach in cancer therapy.
Expression and purification of recombinant human granulocyte colony‐stimulating factor (rG‐CSF) from Pichia pastoris Sembiring, Enny Rimita; Fuad, Asrul Muhammad; Suryadi, Herman
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.93609

Abstract

Recent advances in biotechnology have sparked global interest in developing biosimilar drugs, particularly those containing physiologically active proteins, such as growth factors and cytokines. The methylotrophic yeast Pichia pastoris can produce and secrete fully active heterologous proteins with strong secretory capacity and low levels of native proteins and has the ability to achieve high cell densities. In this study, a yeast‐based system was used to express and purify recombinant human granulocyte colony‐stimulating factor (rG‐CSF). Cultures were induced every 12 h for 48 h to express rG‐CSF, and parameters such as cell density, media pH, and cell dry weight were observed. Cell density increased along with the corresponding secretion of rG‐CSF during the induction period, as determined by Western blot assay, while the pH of the media remained stable. Ammonium sulfate at different saturation levels was used to precipitate the recombinant protein, with the highest total protein content determined spectrophotometrically at 29.6 µg/mL. Ni‐NTA resin with affinity column purification was used to purify the recombinant protein. The purified protein showed rG‐CSF with a molecular weight of approximately 18 kDa based on SDS‐PAGE analysis and immuno slot blot assay detected in purple. Overall, the study results indicated that the production and purification of rG‐CSF was successful, although optimization was required. The long‐term goal of this research is to discover alternative methods and sources for producing biosimilars of the therapeutic protein rG‐CSF, which can be utilized in the pharmaceutical industry to support health programs, particularly cancer treatment.
Omics strategies for crop improvement in response to climate change‐imposed abiotic stress Shourie, Abhilasha; Madaan, Nishtha; Saini, Paridhi
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.94026

Abstract

Given the current status of climate change and its impact on global food security, it is imperative to improve the abiotic stress tolerance of crop plants to enhance productivity. Traditional plant breeding methods have been widely employed to develop climate‐resilient crops; however, their success has been limited due to the lack of understanding of the complex relationships between genes and stress‐related phenotypes. The advent of modern genomics has enabled the expression analysis of stress genes in plants, as genome‐wide information is readily accessible and can be utilized to assign and validate the gene functions. This article highlights the potential applications and limitations of present‐day genomic technologies based on genome mapping, gain or loss‐of‐function analysis for identification of the role of a particular gene in abiotic stress response in plants. Such technologies are highly efficient in candidate gene identification; gene‐trait relationships establishment; functional elucidation of genes; and stress genes modification in crop plants. Modern high throughput genomic technologies offer wide scope for deciphering the complexities of genetic regulation of stress in plants; modulating stress responses; and developing stress tolerance in crop plants against drought, temperature, salinity, osmotic imbalance, herbicides and heavy metal toxicity.
A robust in planta Agrobacterium‐mediated transformation in red chili (Capsicum annuum L.) Hamdani, Anti Damayanti; Nugroho, Syarul; Esyanti, Rizkita Rachmi; Faizal, Ahmad; Suhandono, Sony
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.94653

Abstract

Plant improvement through in vitro culture and genetic engineering is a significant aspect of breeding programs aimed at producing disease‐resistant cultivars of disease‐prone red chili (Capsicum annuum L.). However, the Capsicum genus is recalcitrant to genetic transformation and in vitro regeneration. Moreover, developing a universal transformation protocol is difficult due to its highly genotype‐dependent nature. Therefore, this study aimed to develop an Agrobacterium‐mediated in planta transformation method applicable to various red chili cultivars. Two open‐pollinated varieties, Tanjung 2 and Ciko, were subjected to transformation. The young seedlings were immersed in transformation medium containing Agrobacterium tumefaciens strain GV3101 harboring the binary vector pCAMBIA1301, which carries the β‐glucuronidase (GUS) gene. GUS histochemical analysis revealed that all the primary transformants of Tanjung 2 and Ciko were identified as chimeric. The average staining in the body of the seedlings was 88.63 + 26.33% in Tanjung 2, and 90.65 + 16.77% in the Ciko variety. More than 50% of the seedlings continued to express GUS in their shoot areas 10 days after Agrobacterium infection, indicating the possibility of transgene inheritance in the following generation. The in planta transformation approach is notably genotype independent, making it a promising standard transformation protocol for different red chili varieties.
Overexpression and purification of YidRv gene from the hypervirulent Klebsiella pneumoniae, and the ability of the gene product in inducing a humoral response Raras, Tri Yudani Mardining; Ajrullah, Mauludy Jutta; Gunawan, Ellen Fenix; Pramesti, Nadya Shafa; Prawiro, Sumarno Reto; Wardani, Agustin Krisna; Helianti, Is
Indonesian Journal of Biotechnology Vol 29, No 4 (2024)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.95222

Abstract

The yidRv gene, isolated from the hypervirulent Klebsiella pneumoniae (hvKP), is a novel gene with an unknown function; however, it has exhibited high homology to the yidR, a gene recognized as potential vaccine candidate. The aim of this study was to clone the yidRv gene from the Indonesian hvKP and to investigate its overexpression in Escherichia coli. In the experiment, yidRv was cloned into pET21 to construct pYik23. Recombinant protein YidRv was produced by growing E. coli BL21 (DE3)/pYik23 in LB medium with ampicillin at 29 °C, inducing protein synthesis with 0.5 mM IPTG for 20 hours. Purification was performed using Ni‐NTA resin, and the purified protein (50 µg) was administered to BALB/c mice to test for the production of IgG, IgM and IgA on 2 days before and day 19th and 37th after the first vaccination. The results show a significant induction of IgG and IgM, but not of IgA antibodies. In conclusion, the yidRv gene was overexpressed in E. coli BL21 (DE3) at high levels in soluble form, with the recombinant protein able to be purified to 90% homogeneity. The recombinant YidRv demonstrated the ability to stimulate the generation of both IgM and IgG antibodies.
Low pH resistant lactic acid bacteria from cow rumen waste Ahimsa Kandi Sariri; Kustantinah Kustantinah; Zaenal Bachruddin; Chusnul Hanim
Indonesian Journal of Biotechnology Vol 30, No 1 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijbiotech.85251

Abstract

This study aims to obtain a new strain of lactic acid bacteria (LAB) with the ability to survive at low pH, resulting from isolation, selection, and identification from rumen waste. The research included four stages: isolation of bacteria from rumen waste, selection, and identification. The selection procedure involved growth of LAB in a low pH medium. Molecular identification procedure was conducted using the 16S rRNA gene sequence amplification method with universal primers 27F (AGAGTTTGATCCTGGCT CAG) and 1429R (TAGGGTTACCTTGTTACGACTT). The results of the isolation and identification were analyzed descriptively, revealing that five petri dishes (5a, 10a, 10b, 16a, and 18b) contained lactic acid bacteria which produced clear zones. Among these, isolate 18b was the only LAB strain that survived in a pH 3.5 medium. The results of the molecular identification using the 16s rRNA gene showed that isolate 18b belonged to Limosilactobacillus fermentum.

Filter by Year

2005 2026