Claim Missing Document
Check
Articles

Found 21 Documents
Search

Phylogenetic Analysis of Cyclocheilichthys apogon and Cyclocheilichthys armatus (Fish: Cyprinidae) from West Sumatra Dewi Imelda Roesma; Djong Hon Tjong; Syaifullah; Dyta Rabbani Aidil
HAYATI Journal of Biosciences Vol. 30 No. 5 (2023): September 2023
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.30.5.895-906

Abstract

Cyclocheilichthys apogon (Beardless Barb fish) and Cyclocheilichthys armatus (Hihgfin Barb fish) in West Sumatra is known by the local name Turiak and Catua fish, respectively, are economically important species. Reducing populations and limited biological information about these fishes make their genetic diversity and phylogenetic relationships crucial. The genetic variation was investigated by analyzing the sequencing of a part of mitochondrial DNA Cytochrome b (Cyt b) and Cytochrome oxidase-I (COI) genes of 23 individuals collected from West Sumatra populations. Phylogenetic analysis revealed the monophyletic lineage of the Cyclocheilichthys group and supported Anematichthys as the synonym of Cyclocheilichthys. C. armatus was closely related to C. janthochir and separated from C. apogon with sequences divergence were 12.7-14.0% (Cyt b) and 9.4%-10.0% (COI). C. apogon and C. armatus have low haplotype diversity and genetic diversity, respectively. Genetic diversity within and among populations with sequences divergence was 0.0-0.8% (Cyt b) and 0.0%-0.7% (COI), respectively. The low-level diversity may signify a possibility of gene flow within and among populations. The current data suggests all populations as a single stock unit. Present genetic information is important to establishing effective population management, conservation, and breeding strategies for Turiak and Catua fish.
Genetic Population of Hypothenemus hampei Ferarri (Coleoptera: Scolytinae) from Coffee (Coffea spp.) in Sumatra, Indonesia Using The Cytochrome Oxidase Subunit I Gene Sitompul, Aida Fitriani; Dahelmi, Dahelmi; Roesma, Dewi Imelda
HAYATI Journal of Biosciences Vol. 32 No. 2 (2025): March 2025
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.32.2.472-483

Abstract

Hypothenemus hampei Ferrari, 1867, is a globally significant pest of coffee (Coffea spp.). Genetic information about H. hampei from various locations, including countries in America, Africa, and Asia (Java, Indonesia), is available. However, the data has yet to be available for Sumatra. This research aims to study the genetic population of H. hampei in coffee plants in Sumatra. In this study, a total of 27 mitochondrial cytochrome oxidase subunit 1 (COI) gene sequences were used to estimate the population genetics of H. hampei in Sumatra, collected from C. arabica, C. canephora, and C. liberica at nine locations. The analysis of the COI gene sequences revealed that they contained 236 base pairs (53.76%) of conserved sites, 203 base pairs (46.24%) of variable sites, 153 base pairs (34.85%) of parsimony sites, and 50 base pairs (11.38%) of informative single sites out of a total of 439 base pairs. Haplotype analysis of the COI gene in H. hampei from Sumatra revealed 10 haplotypes, with a haplotype diversity (h) of 0.649 and nucleotide diversity (π) of 0.004. Genetic differentiation (Fst) of H. hampei is low among populations in Sumatra. Genetic variation within populations is higher, and between populations is low. The genetic distance of 0-0.28%, 27 H. hampei sequences from Sumatra are in the same branch, indicating low genetic variation. This information holds great potential for designing sustainable control strategies to manage this pest species in coffee plants, particularly in the Sumatra region.
Authentication of Barbonymus spp. From Lake Singkarak Using DNA Barcoding: Authentication of Barbonymus spp. From Lake Singkarak using DNA Barcoding Salis, Viola Mutiara; Roesma, Dewi Imelda; Tjong, Djong Hon; Syaifullah; Aadrean; Dahelmi
Journal of Tropical Life Science Vol. 14 No. 3 (2024)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/jtls.14.03.15

Abstract

The local community distinguishes between Barbonymus belinka (Balingka) and Barbonymus schwanefeldii (Kapiek) in Lake Singkarak based on size due to the morphological similarities between the two species. From previous reports, B. belinka (Balingka) is a fish endemic to Lake Singkarak, West Sumatra, while B. schwanefeldii has a wider distribution, including Sumatra, Kalimantan, and Java. Consequently, molecular identification is necessary to discern between the species and to understand the DNA barcode characteristics of fish belonging to the genus Barbonymus in Lake Singkarak. One molecular technique utilized for species identification is DNA barcoding, which focuses on the COI (Cytochrome Oxidase Subunit I) gene. Liver tissue samples from Balingka and Kapiek fish from Lake Singkarak were used in the study. Based on 585 bp of COI gene sequences and 30 comparison sequences from BOLD system and GenBank NCBI, seven samples from Lake Singkarak show a genetic distance of 0–1.2% from B. schwanefeldii populations elsewhere, with 15 differing nucleotide bases. Moreover, samples from Lake Singkarak show a genetic distance of 7.7–8.2% from B. belinka in the BOLD system from Aceh, with 42 differing nucleotide bases. Furthermore, two specific bases are present in B. schwanefeldii from Lake Singkarak. Based on the results of this research, it is known that all samples from Lake Singkarak, including Balingka and Kapiek, belong to the same species, namely B. schwanefeldii.
DIVERSIFIKASI OLAHAN PISANG MELALUI PENGABDIAN MASYARAKAT: MEWUJUDKAN KEMANDIRIAN EKONOMI BERBASIS NAGARI DI DESA SAUREINU, SIPORA SELATAN Mairawita; Solfiyeni; Roesma, Dewi Imelda; Mildawati; Pujani, Vera; Rahman, Taufik; Fauzania, Salsa
Jurnal Abdi Inovatif : Pengabdian kepada Masyarakat Vol. 4 No. 1 (2025): Jurnal Abdi Inovatif : Pengabdian kepada Masyarakat
Publisher : Universitas Nusa Bangsa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31938/jai.v4i1.793

Abstract

Abstract Saureinu is a village located in the interior of Sipora Island, Mentawai Islands Regency. The majority of the village's population works as banana farmers. This community service activity aims to build the Saureinu Village community's capacity to manage banana potential into high-value products, support the village's economic independence, and strengthen the community-based economy. The methods used include a participatory approach with stages of potential and problem surveys, technical training on banana product diversification, and training in small business management and marketing through digital platforms. The results of this program show significant success in improving the skills of the Saureinu Village community in processing bananas into various innovative products with economic value. Products such as banana chips with multiple flavors, banana jam, nuggets, and frozen bananas ready to fry are the main results of the training and mentoring provided. These products have been successfully developed and marketed locally and through a wider distribution network, opening up new market opportunities for the community. In addition, this program positively impacts community income due to the sale of processed banana products. Participants also gain a deeper understanding of small business management, from raw material management to marketing strategies, including digital marketing relevant to current market needs. With the increase in skills and knowledge, the community is more confident in developing businesses based on local potential, which ultimately supports the creation of community-based economic independence. This program proves that processing local agricultural products can effectively improve community welfare in a sustainable manner. Keywords: Saureinu Village, marketing, banana products, small businesses Abstrak Saureinu merupakan salah satu desa yang terletak di pedalaman Pulau Sipora, Kabupaten Kepulauan Mentawai. Mayoritas penduduk desa ini berprofesi sebagai petani pisang. Kegiatan pengabdian kepada masyarakat ini bertujuan membangun kapasitas masyarakat Desa Saureinu dalam mengelola potensi pisang menjadi produk bernilai jual tinggi, mendukung kemandirian ekonomi nagari, serta memperkuat ekonomi berbasis komunitas. Metode yang digunakan meliputi pendekatan partisipatif dengan tahapan survei potensi dan permasalahan, pelatihan teknis diversifikasi produk pisang serta pelatihan manajemen usaha kecil dan pemasaran melalui platform digital. Hasil program ini menunjukkan keberhasilan signifikan dalam meningkatkan keterampilan masyarakat Desa Saureinu dalam mengolah pisang menjadi berbagai produk inovatif yang bernilai ekonomis. Produk-produk seperti keripik pisang aneka rasa, selai pisang, nugget dan pisang beku siap goreng menjadi hasil utama dari pelatihan dan pendampingan yang diberikan. Produk-produk tersebut tidak hanya berhasil dikembangkan, tetapi juga telah dipasarkan baik di tingkat lokal maupun melalui jaringan distribusi yang lebih luas, membuka peluang pasar baru bagi masyarakat. Selain itu, program ini memberikan dampak positif berupa peningkatan pendapatan masyarakat sebagai hasil dari penjualan produk olahan pisang. Peserta juga mendapatkan pemahaman yang lebih mendalam tentang manajemen usaha kecil, mulai dari pengelolaan bahan baku hingga strategi pemasaran, termasuk pemasaran digital yang relevan dengan kebutuhan pasar saat ini. Dengan adanya peningkatan keterampilan dan pengetahuan tersebut, masyarakat lebih percaya diri dalam mengembangkan usaha berbasis potensi lokal, yang pada akhirnya mendukung terciptanya kemandirian ekonomi berbasis komunitas. Program ini membuktikan bahwa pengolahan hasil pertanian lokal dapat menjadi solusi yang efektif untuk meningkatkan kesejahteraan masyarakat secara berkelanjutan. Kata Kunci:  Desa Saureinu, pemasaran, produk pisang, usaha kecil
Haplotype diversity of Nemacheilus pfeifferae on the two sides of the Bukit Barisan Mountain Range, West Sumatra: Haplotype diversity of Nemacheilus pfeifferae Aidil, Dyta Rabbani; Roesma, Dewi Imelda; Tjong, Djong
Journal of Tropical Life Science Vol. 15 No. 1 (2025)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/

Abstract

Nemacheilus pfeifferae is one of the native species from Sumatra Island. The previous morphological study on Nemacheilus pfeifferae from several locations on the two sides of the Bukit Barisan Mountain Range, West Sumatra, showed a significant differentiation. The Bukit Barisan Mountain Range is considered to contribute to that differentiation. This hypothesis was tested by identifying the haplotype diversity of N. pfeifferae from the two sides of the Bukit Barisan Mountain Range using the cytochrome b gene from mitochondrial DNA. The samples were collected from seven geographical populations consisting of four rivers flowing west and three rivers flowing east of the Bukit Barisan Mountain range. The tissue samples were DNA extracted, DNA amplified, DNA sequenced, and analyzed using molecular software. Overall, the result showed that N. pfeifferae from West Sumatra has a sequence divergence of 0.6%-5.5%. No haplotypes were shared between populations of N. pfeifferae from West Sumatra. N. pfeifferae in West Sumatra has high haplotype diversity and moderate nucleotide diversity. The sequence divergences of N. pfeifferae within the western populations are higher than in the eastern populations. Nemacheilus pfeifferae from the western part of Bukit Barisan has high sequence divergences (2.9%-4.8%) with the eastern part of Bukit Barisan. The phylogenetic tree shows the separation of N. pfeifferae populations on the two sides of the Bukit Barisan Mountain Range. Nemacheilus in Asia forms a polyphyletic group supported by a high bootstrap value. The Bukit Barisan Mountain Range has played a significant role in the presence of genetic variation
DNA Barcoding and eDNA Metabarcoding for Identification Species: A Case Study (West Sumatra): DNA barcoding and eDNA metabarcoding Roesma, Dewi Imelda; Tjong, Djong Hon; Syaifullah, Syaifullah; Nofrita, Nofrita; Janra, Muhammad Nazri; Aidil, Dyta Rabbani; Prawira, Furqan Dwiki Lintang; Salis, Viola Mutiara
Journal of Tropical Life Science Vol. 15 No. 1 (2025)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/

Abstract

The biodiversity of freshwater fish is important to study because there is data and information that remain undiscovered. The waters of Sumatra, especially West Sumatra, are areas with high freshwater fish diversity but have limited information. Providing information and genetic data has become one of the important things to conduct. DNA barcoding and eDNA metabarcoding have become molecular methods for identifying species and providing information about the presence of species in a region. A study using DNA barcoding and eDNA metabarcoding was conducted on freshwater fish in several locations in West Sumatra. Isolation and amplification of DNA were performed directly on individual samples and sequenced using conventional methods (Sanger sequencing) to generate DNA barcodes. Water samples were collected (2 liters) at each location using a sterile bottle. The water samples were filtrated, isolated, and amplified using universal primer and sequenced with next-generation sequencing techniques. The study successfully collected 25 species belonging to 14 genera, 2 families, and 1 order. A total of 134 sequences from West Sumatra with a length of 648-670 bp were analyzed. All DNA barcodes were submitted to the BOLD System and GenBank, NCBI. The mean Kimura two-parameter model (K2P) genetic distances within species, genera, families, and orders were 0.7%, 8.3%, 15.8%, and 21.3%, respectively. The eDNA metabarcoding technique has successfully detected three native fish species in the waters of West Sumatra (Barbonymus schwanefeldii, Mystacoleucus padangensis, and Rasbora jacobsoni). The availability of fish DNA barcodes in reference databases is crucial for the success of identification using eDNA metabarcoding. Combining identification using conventional methods and eDNA metabarcoding can provide more reliable results and become a reference for future freshwater monitoring.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Distribution and Sign of Otter Presence Across Rice Fields in 2x11 Kayu Tanam, West Sumatra Sidik, Muhamad Rayhan; Aadrean, Aadrean; Nurdin, Jabang; Roesma, Dewi Imelda; Usio, Nisikawa
Jurnal Biologi Tropis Vol. 25 No. 4 (2025): Oktober-Desember
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4.9602

Abstract

Otters (subfamily Lutrinae) consist of 13 species distributed worldwide; however, their populations have been steadily declining due to land-use changes and hunting, while information on their presence in the rice fields of 2x11 Kayu Tanam District remains undocumented. This study was conducted with the objective of identifying and document tracks and signs of otter presence in the rice fields of 2x11 Kayu Tanam District. The research was conducted from November 2023 to February 2024 using a field survey method by observing tracks, spraints, and prey remains to determine the distribution of otter signs. Based on the distribution of tracks and signs found, it is suspected that only one species occurs in the area, namely Aonyx cinereus (small-clawed otter). The presence of Aonyx cinereus in the rice fields of 2x11 Kayu Tanam District was confirmed through tracks and other signs of activity. These findings provide a foundation for further research on otter ecology in rice field ecosystems and highlight the importance of conservation efforts to sustain their habitats.
Inovasi Manajemen Laboratorium Menggunakan QR Code dan Google Spreadsheet dalam Penggunaan Alat dan Bahan di Laboratorium Genetika dan Biomolekuler Agesi, Anugrah Viona; Roesma, Dewi Imelda; Zainal, Zainal; Zulkarnain, Alivia
Indonesian Journal of Laboratory Vol 8, No 3 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijl.v8i3.110795

Abstract

Logbook dan dokumen instruksi penggunaan alat merupakan komponen penting dalam pengelolaan laboratorium. Namun, sistem pencatatan manual yang masih banyak digunakan sering menimbulkan berbagai kendala, seperti keterlambatan input data, risiko kehilangan dokumen, serta rendahnya keterlacakan penggunaan alat dan bahan. Oleh karena itu, diperlukan efisiensi dan inovasi dalam manajemen laboratorium melalui penerapan pendekatan berbasis QR Code dan Spreadsheet. Digitalisasi menggunakan QR Code dalam pengelolaan laboratorium sebenarnya bukan hal baru, karena telah banyak laboratorium yang menerapkannya. Namun, banyaknya QR Code yang perlu discan oleh pengguna laboratorium menjadi kendala dalam keefektifan penerapan digitalisasi logbook, karena terlihat kurang sederhana. Modifikasi dengan mengintegrasikan seluruh dokumen ke dalam satu sistem berbasis QR Code yang terhubung dengan Google Spreadsheet, dapat mengoptimalkan digitalisasi di laboratorium. Pendekatan ini dapat meningkatkan efisiensi, akurasi, serta keterlacakan data di laboratorium. Inovasi ini penting dilakukan untuk meningkatkan kualitas manajemen laboratorium dan tertib administrasi melalui pencatatan penggunaan alat dan bahan secara digital. Tujuan kegiatan ini adalah mengaplikasikan sistem QR Code dan Google Spreadsheet untuk memonitor penggunaan alat dan bahan di Laboratorium Genetika dan Biomolekuler. Metode yang digunakan adalah survei deskriptif dengan membandingkan kondisi sebelum dan sesudah penerapan sistem tersebut. Hasil menunjukkan bahwa penerapan QR Code dan Google Spreadsheet terbukti mampu mengoptimalkan digitalisasi administrasi laboratorium serta tidak menimbulkan kendala berarti dalam implementasinya.
Variasi Morfologi Fejervarya cancrivora Gravenhorst, 1892 (Anura: Dicroglossidae) di Sumatra Barat Huda, Nadyatul Khaira; Tjong, Djong Hon; Roesma, Dewi Imelda
BEST Journal (Biology Education, Sains and Technology) Vol 7, No 2 (2024): September 2024
Publisher : Program Studi Pendidikan Biologi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30743/best.v7i2.9687

Abstract

Bukit Barisan sebagai barrier ekologi yang dapat membatasi migrasi dan aliran gen khususnya amfibi. Penelitian ini bertujuan untuk melacak variasi morfologi Fejervarya cancrivora di Sumatra Barat berdasarkan morfometrik. Total 120 individu F. cancrivora dari enam populasi meliputi Padang, Pariaman dan Pesisir Selatan sebagai bagian barat Bukit Barisan. Pasaman, Limapuluh Kota dan Sijunjung sebagai bagian timur Bukit Barisan. Hasil analisis data morfometrik didapatkan 13 karakter yang bervariasi pada individu-individu jantan yaitu SL, EN, TEL, MN, HAL, FAL, HLL, THIGHL, TL, FOL, TFOL, 3FL and 1FL.dan 16 karakter bervariasi pada individu-individu betina yaitu SVL, HL, MSL, NS, SL, TEL, MN, MFE, IN, IOD, FAL, THIGHL, FOL, 4TL, IMTL and 1 TL. Berdasarkan hasil analisis PCA menunjukkan keenam plot saling tumpang tindih. Dapat disimpulkan bahwa meskipun terdapat karakter yang bervariasi, tidak ada perbedaan secara signifikan yang memisahkan satu populasi dengan populasi lainnya..