Article Per Year (5 Year)
p-Index From 2020 - 2025
1.829
P-Index
This Author published in this journals
All Journal Jurnal Ilmiah Kedokteran Wijaya Kusuma Jurnal SainHealth Indonesian Journal of Clinical Pathology and Medical Laboratory (IJCPML) Journal of Multidisciplinary Applied Natural Science Prosiding Seminar Nasional Kusuma Prosiding Seminar Nasional COSMIC Kedokteran
Sri Lestari Utami
Universitas Wijaya Kusuma Surabaya
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Economics, Econometrics & Finance Energy Environmental Science Health Professions Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Neuroscience Nursing Physics Public Health

Published : 10 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 10 Documents
Search

 1 
ANALISIS NILAI SKOR-T LUMBAL, KADAR TNF-A, DAN HUBUNGANNYA PADA POSTMENOPAUSE OSTEOPOROSIS POSYANDU-LANSIA Sri Lestari Utami; Nini Primadhani Paras Shinta Dewi; Rini Purbowati
Jurnal SainHealth Vol 5, No 2 (2021): September 2021
Publisher : Faculty of Health Sciences Universitas Maarif Hasyim Latif

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51804/jsh.v5i2.1522.24-31

Abstract

Indonesian women have four times higher rates of osteoporosis than men. This is caused by aging and the hormone estrogen, which halts production at menopause. Tumor Necrosis Factor-? (TNF-?) and other inflammatory cytokines play a role in the process of bone loss caused by an imbalance of osteoblast and osteoclast activity. This study aims to determine the prevalence of osteoporosis in postmenopausal women at the Elderly Integrated Service Post (Posyandu Lansia) based on the value of Bone Mineral Density (BMD) with lumbar T-score and TNF-levels and to analyze various possible relationships between the two. The research method has two stages. The first stage is screening activities at the Posyandu Lansia according to the inclusion and exclusion criteria using a questionnaire and measuring the BMD (bone mineral density) value with a sonometer. The second stage involves establishing the diagnosis of osteoporosis in 58 postmenopausal women with Dual Energy X-Ray Absorptiometry (DXA) and taking serum for analysis of TNF-? levels. TNF-? levels were determined using the ELISA.The results showed that the prevalence of osteoporosis in postmenopausal women at the Posyandu Lansia was 60.3% based on the value of bone mass density with a lumbar T-score. The percentage of the respondent group with TNF-? levels below the limit value on the standard curve for normal people in the kit (15.6 pg/mL) was 50%. Relationship analysis showed that there was no association between TNF-? levels and BMD values at the lumbar T-score (p value = 0.063 > 0.05). The same thing was also shown in the relationship between the osteoporosis group (Categories 1 and 2) and TNF-? levels (p-values of 0.864 and 0.788 respectively. Analysis of the relationship in this study needs to be carried out more deeply because of the classic and paradoxical effects of TNF-? on the role of osteoclastogenesis.Keywords: osteoporosis, TNF-?, lumbar T-score, postmenopause women
Serum Receptor Activator of Nuclear Factor-κβ Ligand and Osteoprotegerin Levels and Ratio in Correlation with Bone Mineral Density Fauqa Arinil Aulia; Sri Lestari Utami; Leonita Anniwati; Sony Wibisono Mudjanarko; Ferdy Royland Marpaung
INDONESIAN JOURNAL OF CLINICAL PATHOLOGY AND MEDICAL LABORATORY Vol 27, No 1 (2020)
Publisher : Indonesian Association of Clinical Pathologist and Medical laboratory

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24293/ijcpml.v27i1.1627

Abstract

Osteoporosis is a disorder represented by manifestations of low bone mass, decreased bone tissue, and disrupted bonemicroarchitecture. The diagnosis of osteoporosis so far has been based on fracture manifestations after minimal trauma orby detecting low Bone Mineral Density (BMD). Measurement of Receptor Activator of Nuclear Factor-κβ Ligand (RANKL)and Osteoprotegerin (OPG) levels has opened the discourse of a more specific assessment of osteoblast and osteoclastregulation. The RANKL/OPG ratio can represent resorption and bone formation more significantly when correlated withBMD features. This study aimed to analyze the correlation between serum RANKL and OPG levels and ratio with BMD. A totalof 58 post-menopausal females from 13 elderly in Integrated Community Health Care Surabaya and Sidoarjo were enrolled.Data were collected by recording age, onset of menarche, onset of menopause, and Body Mass Index (BMI). Serum RANKLand OPG levels were evaluated using sandwich ELISA from Elabscience®. The RANKL/OPG ratio was obtained from the ratiobetween measured RANKL and OPG levels in serum. The proximal femur and lumbar spine BMDs were measured usingHologic® Discovery™ QDR™ Dual-Energy X-ray Absorptiometry (DEXA). Pearson's correlation test in this study showed nosignificant correlation between BMD and RANKL levels (lumbar: p=0.203; hip: p=0.283). The insignificant result was alsoshown in the correlation between BMD and OPG levels (lumbar: p=0.412; hip: p=0.617). A significant result between lumbarBMD and RANKL/OPG ratio was only found in the osteopenia subjects (p=0.001). The RANKL/OPG ratio had a significantcorrelation only with osteopenia-BMD in post-menopausal females. Therefore, it could be used as supporting data inosteoporosis screening.
AIR GANDARUSA (Justicia gendarussa Burm. f.) DAN GAMBARAN GEN HYALURONIDASE LEWAT ANALISIS PCR Sri Lestari Utami; Didik P. Restanto; Bambang Prajogo EW
INDONESIAN JOURNAL OF CLINICAL PATHOLOGY AND MEDICAL LABORATORY Vol 19, No 2 (2013)
Publisher : Indonesian Association of Clinical Pathologist and Medical laboratory

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24293/ijcpml.v19i2.1059

Abstract

Gandarusa (J. gendarussa Burm. f.) is an etnomedicine which is used as a male contraceptive alternative, known to inhibit the enzymefunction of spermatozoa hyaluronidase during fertilization. One of the ideal contraceptive conditions is the safetyness (among others nonmutagenic), requiring a long research during the verification process. The early research is the gene expression of hyaluronidase mice(M.musculus L.) testis given water fraction of the gandarusa with PCR analysis. The total RNA was isolated from the normal mice testis(as the negative control or no treatment group) and the mice testis from the treatment groups. The treatment groups consisted of group Iand II treated with water fraction of the gandarusa 15 mg/20 gr BW and 7.5 mg/20 gr BW, subsequently, the positive control group wasalso given hesperidins 1 mg/20 gr BW once a day per oral during the 1.5 times of spermatogenesis cycle (for 55 days). The results of thestudy showed that (1) the cDNA fragment confirmed as the gene of hyaluronidase mice testis (with 710 bp length of nucleotide) passedthrough RT-PCR at the total RNA negative control group, sequenced, isolated and alignment in the NCBI gene bank. (2) the same cDNAfragment gene of hyaluronidase mice testis (from the negative control group) did not transcript in the treatment I and positive controlgroups (where there is no band), but this gene will be transcripted in the treatment II group (where the band is emerged).
Pengembangan Potensi Universitas Wijaya Kusuma Surabaya Menjadi Universitas Riset melalui Pembentukan Kelompok Riset – Tinjauan Literatur Sri Lestari Utami
Jurnal Ilmiah Kedokteran Wijaya Kusuma Vol 11, No 1 (2022): MARET 2022
Publisher : Universitas Wijaya Kusuma Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (490.788 KB) | DOI: 10.30742/jikw.v11i1.1600

Abstract

Various universities founded as research universities in the 19th century conducted research that assisted the progress of various fields in European and American countries. Research universities/research-based universities are characterized by the presence of research activities in the Tri Dharma of Higher Education. Several universities in Indonesia have declared themselves to be research universities, and others are in the process of doing so. Research universities must meet various indicators, all of which stem from research activities. The purpose of this paper is to investigate and compare the readiness of Universitas Wijaya Kusuma Surabaya (UWKS) to become a research university. One method for achieving these goals is the formation of research groups. This essay uses a narrative review design. A UWKS is a private university founded in 1981 in Surabaya, East Java. A long track record of research since its establishment is sufficient provision to prepare it to become a research university. This is also supported by the university's academic community and the foundation that manages it, when viewed from the vision, mission, and objectives. The formation of various research groups could be the start of the development of research universities. They will enable lecturers to produce targeted outputs as indicators of research performance, such as research groups for early detection of chronic degenerative diseases based on specific Indonesian polymorphisms. The paper's conclusion was that UWKS has the potential to become a research university based on its track record. The formation of many research groups is one way to accomplish this.
Identifikasi Polimorfisme Gen Interleukin-6 -385A/T dan -386A/T pada Wanita Postmenopause Suku Jawa dengan Osteoporosis Sri Lestari Utami
Prosiding Seminar Nasional Kusuma Vol 1 (2023): Prosiding Seminar Nasional Kusuma
Publisher : LPPM UWKS

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Penelitian tentang variasi genotip pada polimorfisme gen IL-6 -174G/C, -572G/C, -597A/G dan -634C/G dan hubungannya dengan jumlah mRNA, kadar protein IL-6 dan nilai skor-T leher femoral pada wanita postmenopause Suku Jawa dengan osteoporosis telah dilakukan. Studi ini bertujuan untuk mengidentifikasi variasi genotip lainnya pada polimorfisme gen IL-6 pada wanita postmenopause Suku Jawa dengan osteoporosis. Penelitian dilakukan pada wanita postmenopause Suku Jawa sebanyak 66 orang. Diagnosis osteoporosis ditegakkan dengan DEXA pada skor-T leher femoral. Genotip polimorfisme promoter gen IL-6 akan diidentifikasi dengan metode Sanger sekuensing satu arah dari PCR produk yang telah dipurifikasi. Primer yang digunakan untuk promoter gen IL-6 terdiri dari 2 sekuen, yaitu Primer 1: 5’ – TCTGAACCAGCTTGAC CCAA – 3’ dan 5’ – CTGTGAGGGGCTGTTGTAGA – 3’ dan Primer 2: 5’ – AGCAGC CAACCTCCTCT AAG – 3’ dan 5’ – GAGCTTCTCTTTCGTTCCCG – 3’. Hasil sekuensing akan dihomologikan dengan bank gen. Single nucleotide polymorphism baru diidentifikasi pada promoter gen IL-6 di posisi 385 dan 386 dengan perubahan basa dari A menjadi T. Ukuran sekuen produk PCR dengan primer 1 dan 2 adalah 572 bp dan 760 bp. Jumlah dan persentase genotip AA, AT dan TT pada polimorfisme gen IL-6-385A/T berturut-turut adalah 51 (77,27%), 8 (12,12%) dan 7 (10,6%). Sedangkan genotip pada IL-6-386A/T adalah AA dan AT dengan frekuensi dan persentase berturut-turut adalah 60 (95,45%) dan 3 (4,5%). Jumlah alel A pada polimorfisme gen IL-6-385A/T dan IL-6-386A/T adalah 110 dan 129, sedangkan alel Tnya berjumlah 22 dan 3. SNP baru promoter gen IL-6 ditemukan di postmenopausal Suku Jawa dengan osteoporosis adalah -385A/T dan -386A/T.
Penguatan Pengetahuan ASI Eksklusif pada Kader Kecamatan Sukomanunggal Untuk Pencegahan Stunting melalui Program Emotional-Demonstration Sukma Sahadewa; Andiani; Wike Herawaty; Sri Lestari Utami
Prosiding Seminar Nasional Kusuma Vol 2 (2024): Prosiding Seminar Nasional Kusuma
Publisher : LPPM UWKS

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Latar belakang: Stunting adalah gangguan pertumbuhan dan perkembangan yang dialami anak akibat gizi buruk, infeksi berulang, dan stimulasi psikososial yang tidak memadai. Kota Surabaya mempunyai prevalensi stunting terendah di Jawa Timur karena berbagai program pada penanganannya melibatkan berbagai pihak termasuk kader kesehatan. Peningkatan kapasitas kader sangat diperlukan mengingat peran kader kesehatan dalam pemberdayaan Masyarakat Bidang Kesehatan. Tujuan: Kegiatan ini bertujuan menguatkan pengetahuan ASI Eksklusif pada kader Kecamatan Sukomanunggal (Kader Surabaya Sehat) untuk pencegahan stunting melalui Program Emotional-Demonstration. Metode: Metode pelaksanaan kegiatan adalah melalui edukasi dengan penyuluhan, pemberian brosur, dan materi. Pretest dan posttest diberikan untuk melihat ada atau tidaknya penguatan pengetahuan atas materi yang diberikan. Pertanyaan yang diberikan berjumlah 10 buah. Uji korelasi Spearman digunakan untuk menganalisis hubungan diantara hasil keduanya. Hasil: Responden kader yang berperan serta berjumlah 195 orang. Perbandingan hasil pretest dan postest yang menunjukkan penguatan pengetahuan berturut-turut adalah peningkatan nilai rata-rata 46,26 dan 87,13. Selain itu juga ditunjukkan pada nilai dengan frekuensi (persentase) terbanyak adalah nilai 40 (50 orang dan 25,6%) pada pretest dan nilai 100 (83 orang dan 42,6%) pada posttest. Uji statistik menunjukkan ada hubungan antara nilai pretest dan posttest (nilai p = 0,002 < 0,05). Kesimpulan: Adanya penguatan pengetahuan ASI Eksklusif pada kader Kecamatan Sukomanunggal melalui Program Emotional-Demonstration diharapkan dapat meningkatkan kapasitas kader untuk menunjang program pencegahan stunting Kota Surabaya, yaitu “zero growth stunting” .  
Edukasi Senam Pembebanan pada Osteoporosis dan Pemeriksaan Densitas Mineral Tulang Lansia Desa Kedanyang (Gresik) Sri Lestari Utami; Ira Idawati; Pratika Yuhyi Hernanda
Prosiding Seminar Nasional Kusuma Vol 2 (2024): Prosiding Seminar Nasional Kusuma
Publisher : LPPM UWKS

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Latar belakang: Osteoporosis (penyakit keropos tulang) menyebabkan peningkatan risiko patah tulang, yang akan meningkatkan morbiditas dan mortalitas penderitanya karena imobilitas.  Osteoporosis dapat dicegah atau dihambat melalui peningkatan kepadatan massa tulang, diantaranya dengan senam pembebanan. Tujuan: Tujuan kegiatan adalah edukasi osteoporosis, kepadatan massa tulang dan pengukurannya, serta senam dengan pembebanan di Posyandu Lansia RW 7 Desa Kedanyang (Kecamatan Kebomas, Gresik), karena hal ini belum pernah dilakukan sebelumnya. Metode: Kegiatan yang dilakukan adalah edukasi manajemen pemeliharaan kesehatan tulang agar terjaga kepadatannya pada osteoporosis melalui penyuluhan untuk peningkatan dan penguatan pengetahuan serta pemahaman tentangnya (diukur melalui pemberian pretest dan postest). Kegiatan lainnya adalah pengukuran kepadatan/densitas massa tulang (Bone Mineral Density/BMD) dan demontrasi atau pelatihan gerakan-gerakan senam dengan pembebanan pada Lansia melalui SEDAP BUGAR LANSIA. Kuesioner faktor risiko osteoporosis yang diisi akan digunakan untuk konsultasi dokter terkait hasil BMD. Pemeriksaan pendukung lainnya yang bisa dikaitkan adalah kadar gula darah acak, Hb, hematokrit, tinggi badan, berat badan, tekanan darah, dan nadi). Brosur berisi informasi yang disampaikan dalam kegiatan, yang berguna untuk Lansia. Hasil: Kegiatan ini diikuti oleh 86 orang (51 laki-laki dan 35 perempuan). Hasil pengukuran BMD (berdasarkan nilai skor T) didapatkan persentase osteoporosis, osteopenia dan normal sebesar 39,5; 40,7; dan 19,8 berturut-turut. Hasil perbandingan jawaban pada pre dan post-test dari 5 pernyataan menunjukkan penurunan jawaban yang salah, tidak ada jawaban atau tidak tahu hingga 0%. Kesimpulan: Penelitian yang lebih mendalam diperlukan untuk menyelidiki faktor risiko yang berpengaruh terhadap kepadatan tulang karena hasilnya menunjukkan persentase massa tulang rendah (osteopenia) yang lebih besar dibandingkan dengan osteoporosis
Faktor Risiko Olahraga Dan Diabetes Melitus Tipe 2 Pada Peserta Posyandu Lansia Desa Suruh (Sidoarjo) Dengan Hipertensi Iis Rahmawati; Ira Idawati; Sri Lestari Utami
Prosiding Seminar Nasional COSMIC Kedokteran Vol 1 (2023): Prosiding Seminar Nasional COSMIC Kedokteran
Publisher : Lembaga Penelitian Dan Pengabdian Kepada Masyarakat Universitas Wijaya Kusuma Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Hipertensi sering disebut sebagai silent killer karena seseorang dengan tekanan darah tinggi seringkali tidak menyadarinya hingga timbul komplikasi yang dapat merusak organ. Individu dengan diabetes mellitus tipe 2 (T2DM) memiliki respon tekanan darah yang lebih besar terhadap olahraga maksimal akut dibandingkan dengan yang non T2DM. Penelitian ini bertujuan untuk mengetahui dan menganalisis hubungan faktor risiko olahraga dan diabetes melitus tipe 2 dengan hipertensi pada Posyandu Lansia Desa Suruh (Sidoarjo). Penelitian ini merupakan penelitian analitik-observasional dengan metode cross sectional. Respondennya adalah 123 peserta Posyandu Lansia Desa Suruh berusia minimal 45 tahun (pre Lansia). Responden akan diukur GDA, tekanan darah dan diberikan kuesioner (riwayat kesehatan, terapi dan olahraga). Analisis data menggunakan analisis informasi statistik non parametrik dengan pendekatan Rank Spearman. Hasil penelitian menunjukkan prevalensi golongan pre hipertensi dan non T2DM tertinggi dengan jumlah responden, yaitu 44 dan 114 (35,8% dan 92,7% ) berturut-turut. Sedangkan 68,3% (84 responden) dari responden tidak melakukan olahraga. Penelitian juga menunjukkan terdapat hubungan yang sedang antara faktor risiko olahraga dengan hipertensi (P = 0,00 dan r = 0,514), dan juga terdapat hubungan yang lemah antara faktor risiko T2DM dengan hipertensi (P = 0,015 dan r = 0,22). Olahraga wajib dilakukan oleh penderita hipertensi, selain menjaga kadar gula darahnya.
TINJAUAN SISTEMATIK: PREVALENSI HIPERTENSI TERKAIT INDEKS MASSA TUBUH, AKTIVITAS FISIK DAN KUALITAS TIDUR PADA REMAJA Sri Lestari Utami; M. Raffli Naresca Pradhana
Prosiding Seminar Nasional COSMIC Kedokteran Vol 2 (2024): Edisi 2024
Publisher : Lembaga Penelitian Dan Pengabdian Kepada Masyarakat Universitas Wijaya Kusuma Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Hipertensi merupakan salah satu penyakit degeneratif yang penderitanya paling banyak di Indonesia. Hipertensi di Indonesia ternyata juga menyerang remaja selain Lansia. Studi ini bertujuan menganalisis hubungan faktor indeks massa tubuh, aktivitas fisik, dan kualitas tidur terhadap kejadian hipertensi pada remaja dengan studi literatur. Metode penulisan menggunakan tinjauan sistematik. Mesin pencari google scholar dan science direct digunakan pada publikasi tahun 2017-2023 dengan kata kunci hipertensi, remaja, indeks massa tubuh, aktifitas fisik, dan kualitas tidur. Jumlah jurnal yang dianalisis sebanyak 37 jurnal. Hubungan yang signifikan antara IMT tinggi (IMT ≥23), obesitas, dan kelebihan berat badan dengan kejadian hipertensi pada remaja terdapat 22 jurnal (nilai p < 0,05) dengan nilai risiko 1,69-26,062. Hubungan ini jika dikaitkan dengan aktivitas fisik yang kurang pada remaja (p<0,05) dengan tingkat risiko sebesar 3,060-6,14, yang berturut-turut ada pada 7 dan 5 jurnal. Hasil analisis menunjukkan terdapat hubungan yang signifikan antara buruknya kualitas tidur dengan kejadian hipertensi remaja (nilai p < 0,05) dan tidak ada hubungan (nilai p > 0,05) pada 7 dan 2 jurnal berturut-turut. Tingkat risikonya adalah sebesar 1,67-5,443, yang ditemukan pada 5 jurnal. Pola makan perlu diwaspadai remaja sebagai faktor risiko yang paling berbahaya bagi munculnya penyakit hipertensi.
Detection of csg and lux Genes in Biofilm-Forming Uropathogenic Escherichia coli Associated with Urinary Tract Infections Rini Purbowati; Sri Lestari Utami; Dadik Raharjo; Masfufatun Masfufatun
Journal of Multidisciplinary Applied Natural Science Vol. 5 No. 1 (2025): Journal of Multidisciplinary Applied Natural Science
Publisher : Pandawa Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47352/jmans.2774-3047.222

Abstract

Uropathogenic Escherichia coli (UPEC) is responsible for 80–90% of urinary tract infections (UTI) in the global population. The emergence of the increasing resistance to broad-spectrum antimicrobial agents was due to the ability to form biofilms. Cell surface factors that play a role in biofilm formation include Quorum Sensing (QS) which is encoded by the luxS family gene and curli by two operons, namely the csgBA operon. The purpose of the study is to detect the effects of 2 virulence genes (csgD and luxS) on biofilm-forming UPEC associated with UTI. As many as 76 UPEC isolates were collected from the clinical microbiology laboratories and the biofilm development was analyzed using the crystal violet method on microplate 96 wells. Using PCR assay, the two studied genes (csgD and luxS) were determined to be present in the isolates. UPEC isolates the bacteria-produced biofilms (90.80%) and nonproducers (9.20%). Most UPEC bacteria (97.36%) are known to be positive for csgD and luxS gene, while the others (92.10%) are known to be positive for the luxS gene. The highest proportion of the genes expressed in this study is followed by the presence of a relationship between the ability to produce biofilm and the presence of the genes under investigation, which is followed by all UPEC strains that cause UTI in humans.
Co-Authors Andiani Bambang Prajogo EW Dadik Raharjo Didik P. Restanto Fauqa Arinil Aulia Ferdy Royland Marpaung Iis Rahmawati Ira Idawati Ira Idawati Leonita Anniwati M. Raffli Naresca Pradhana Masfufatun Masfufatun Nini Primadhani Paras Shinta Dewi Pratika Yuhyi Hernanda Rini Purbowati Rini Purbowati Sony Wibisono Sukma Sahadewa, Sukma Wike Herawaty