Claim Missing Document
Check
Articles

Found 15 Documents
Search

Pewarisan Sifat Densitas Stomata dan Laju Kehilangan Air Daun (rate leaf water loss RWL) pada Kacang Tanah (Arachis hypogaea L.) Adisyahputra, Adisyahputra; Sudarsono, Sudarsono; Setiawan, Kukuh
Jurnal Natur Indonesia Vol 14, No 1 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (453.975 KB) | DOI: 10.31258/jnat.14.1.73-89

Abstract

The aim of this research is to analyze and examine the inheritance of stomatal density trait and RWL as a variable in drought tolerance ofpeanut. The experiment was conducted by using cv. Kelinci that is sensitive genotype as female parent and US 605 which is tolerantgenotype as male parent, including population off spring from hybrid cv. Kelinci (P1) with US 605 (P2). Stomatal density was determinedby making leaf imprint and by observing leaf imprint under microscope. Relative water loss was determined by dipping peanut leaf in PEG40% for 48 hours. Result of the analysis showed that stomatal density and RWL were not only controlled by qualitative characters of majorgene, but also controlled by quantitative character of minor gene by polygenic with the complex gene action. Both characters seem toinfluence more as genetic factor and have high level fixation additive varians which can give the opportunity to obtain the tolerant offspring.
Sosialisasi Pembuatan Kertas Dari Limbah Daun Serai Wangi Adisyahputra, Adisyahputra
Dharma Pengabdian Perguruan Tinggi (DEPATI) Vol 3 No 2 (2023): November 2023
Publisher : Fakultas Teknik, Universitas Bangka Belitung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33019/depati.v3i2.4501

Abstract

Distilling citronella produces quite a large amount of citronella leaf waste. Each harvest season produces around two tons of wet citronella leaves which are then distilled to produce essential oil, leaving behind waste. Based on this, service was carried out in Jada Bahrin Village through outreach in processing citronella leaf waste into paper. It is hoped that this service can support the priority development of the 2017-2045 National Research Master Plan which focuses on the food-agriculture sector while still referring to the Bangka Belitung University Community Service Strategic Plan for 2021-2025.
Keragaman Karakter Morfologi, Komponen Hasil, dan Hasil Plasma Nutfah Kedelai (Glycine max L.) Putri, Priskilla Purnaning; Adisyahputra, Adisyahputra; Asadi, Asadi
Bioma Vol. 10 No. 2 (2014): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (345.057 KB) | DOI: 10.21009/Bioma10(2).7

Abstract

Abstract Soybean (Glycine max L.) is annual crop that have high morphologies and yield components diversity. The research was conducted at the first season of 2011, the objective of the research were to find morphological, yield, and yield component of Soybean germplasm (Glicine max L.). The research was carried out at experimental station BB-BIOGEN Citayam, Depok, and laboratory of Gene Bank BB-BIOGEN. The experiment used randomized block design with 100 different accessions and three replications for each accession. Based on the observation, the morphological characters have many visual forms. They are as follows: growth percentage in which 19.33 – 99%; growth types were determinate and indeterminate, the leave form was triangle to sharp; purple and white flowers; yellow and black seeds color. The range of values for each characteristic component are as follows: plant height 29,23 – 104,25 cm; number of pods per plant was 23,6 – 99,82; flowering time 33 – 47 days after planting; 100 seed weight 5,98 – 20,77 gram; maturing time 75 – 96,67 days after planting; root nodule’s weight 0,004 – 0,109 gram; seed’s weight 3,15 – 11,45 gram/plant. Among the accessions, the highest yield was shown by B 4323 (643,27 gram/3,6 m2). Significant correlation was shown between soybean’s yield components and yield which were plant’s height, growth percentage, numbers of main stem’s node, numbers of pods, seeds weight for each plant and root nodule’s weight. 100 seeds weight showed significant negative correlation with soybean components. Key words: germplasm, morphological characteristics, soybean, yield components
SELEKSI TOLERANSI PADI RAWA TERHADAP PH RENDAH DAN PIRIT TINGGI PADA TAHAP VEGETATIF AWAL Wibisono, Kunto; Adisyahputra, Adisyahputra; Azrai, Eka Putri
Bioma Vol. 11 No. 2 (2015): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (650.898 KB) | DOI: 10.21009/Bioma11(2).8

Abstract

ABSTRAK Salah satu upaya meningkatkan produktivitas padi ialah dengan memanfaatkan lahan suboptimal yang mempunyai kadar pH rendah dan pirit tinggi. Perakitan padi rawa diharapkan mampu untuk beradaptasi pada kondisi pH rendah dan pirit tinggi tersebut sehingga dapat meningkatkan produktivitas padi di Indonesia. Penelitian ini bertujuan untuk menguji respon toleransi enam galur padi rawa terhadap pH rendah (pH 3 – 4) dan pirit tinggi (300 – 400 ppm) pada tahap vegetatif awal. Penelitian ini dilakukan di Laboratorium Fisiologi FMIPA UNJ pada bulan Januari sampai Juni 2015. Metode yang digunakan dalam penelitian ini adalah eksperimen dengan menggunakan desain rancangan acak lengkap pola faktorial yang terdiri dari tiga faktor. Faktor pertama adalah pH yang tingkat keasamannya rendah (pH 3 – 4) dan tinggi (pH 5 – 6). Faktor kedua adalah pirit dengan konsentrasi rendah (100 – 200 ppm) dan tinggi (300– 400 ppm). Faktor ketiga adalah galur padi rawa yang terdiri dari Inpara 4, Inpara 5, Inpara 6, Inpara 7, Sei Lalan, dan Banyuasin. Parameter yang diukur dalam penelitian ini panjang daun, lebar daun, panjang batang, panjang akar, berat kering daun, berat kering akar, dan klorofil total. Semua parameter diamati dianalisis secara deskriptif dengan menghitung rata-rata dan standar error (±SE). Berdasarkan hasil penelitan didapatkan hasil galur yang toleran terhadap pH rendah dan pirit tinggi adalah Sei Lalan. Kata Kunci : galur padi, pH, pirit, vegetatif awal
INDUKSI MUTASI PADA PISANG (Musa sp. - ABB) cv. KEPOK DENGAN IRADIASI GAMMA SECARA IN VITRO Masykuroh, Luthfia; Adisyahputra, Adisyahputra; Indrayanti, Reni
Bioma Vol. 12 No. 1 (2016): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (534.258 KB) | DOI: 10.21009/Bioma12(1).3

Abstract

Banana (Musa sp. - ABB) cv. Kepok is one of type banana processed that have a very potential commodities fruit developed to support food survival. The purpose of this study was to knowing the effect of gamma irradiation on the growth of banana plants cv. Kepok in vitro. This study was conducted in October 2014 – October 2015 in Plant Tissue Culture Laboratory, Biological – Science UNJ. The methods used was experiment with fully randomized design. Factors that tested was 6 gamma irradiation doses (0, 20, 30, 40, 50, 60 Gy) with 10 repetition. Observation of phenotypic generate diverse characters on the growth of the number of shoots and leaves. Gamma irradiation dose of 50 Gy is doses most inhibits the growth of character. Mutations that occur in banana plantlets cv. Kepok generated by the treatment doses gamma irradiation induced mutation is random.
EFEKTIVITAS MEDIA PERTUMBUHAN KHAMIR KOMERSIAL (Saccharomyces cerevisiae) UNTUK FERMENTASI BIOETANOL DARI ECENG GONDOK (Eichhornia crassipes): Effectiveness of Growth Media Commercial Yeast (Saccharomyces cerevisiae) For Bioethanol Fermentation From Water Hyacinth (Eicchornia crassipes) Febriyanti, Anugerah Eka; Sari, Cut Nanda; Adisyahputra, Adisyahputra
Bioma Vol. 12 No. 2 (2016): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (481.903 KB) | DOI: 10.21009/Bioma12(2).6

Abstract

This study aims to find growth medium commercial yeast (S.cerevisiae) and determine the optimum composition of bioethanol fermentation. This research was conducted at the Laboratory of Bioprocess PPPTMGB “LEMIGAS” along May to September 2015. The method used is experiment using a completely randomized design consisting of two treatment. The first treatment is an alternative growth media utilization, namely, tofu liquid waste, coconut water and a mixture of both. The second treatment is the composition of the fermentation with sugar content of 100 ml, 150 ml and 200 ml with the addition of 10 ml starter in each experiment. Data of commercial yeast cell growth (S.cerevisiae) on alternative growth media were analyzed by Anova one way. The results showed that there was an interaction of commercial yeast cell growth (S.cerevisiae) on alternative growth media. Post-hoc test showed the alternative media that consists of a mixture of tofu liquid waste and coconut water produce the highest commercial yeast cell growth at 25,8 x107 with a 7.62 log value (cells/ml). The most optimum of bioethanol produced in the fermentation process is on sugar 100 ml by the addition of 10 ml starter acquire as much as 45 ml of ethanol content.
SELEKSI SENYAWA PENGHIDROLISIS UNTUK MENGHASILKAN GULA REDUKSI DARI LIMBAH KULIT ARI KEDELAI SEBAGAI BAHAN FERMENTASI BIOETANOL Zulkifliani, Zulkifliani; Handayani, Siska; Adisyahputra, Adisyahputra; Sakarani, Devitra
Bioma Vol. 13 No. 1 (2017): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (657.44 KB) | DOI: 10.21009/Bioma13(1).1

Abstract

This study aims to determine the most effective compound used to hydrolyze soy husk waste to produce reducing sugar as raw material for bioethanol fermentation. The study was conducted at the Laboratory of Bioprocess PPPTMGB "LEMIGAS" in April-September 2015. The method used is experiment using a randomized block design consisting of two factors. The first factor is the type of compounds used in the process of hydrolysis, namely H2SO4, HCl, NaOH, and NH3. The second factor is the concentration of hydrolyze compound 0.2%, 0.4%. 0.6%, 0.8%, and 1% (v/v) and every treatment repeated 4 times. Parameters measured were content of reduced sugar hydrolysis product, and secondary data that content of cellulose and hemicellulose also the density of ethanol. Concentration of reducing sugar from hydrolysis of soybean husk is analyzed by two-way ANOVA test. ANOVA analysis result indicate that the best hydrolysis compounds in hydrolizing soybean husk is HCl with the optimum concentration is 0,4%. And there are interactions between treatment of compound used to hydrolyze as well as concentration on reducing sugar concentration (mg/mL) as product from soybean husk waste hydrolysis. Post-hoc test showed that HCl 0,4% produce the highest concentration of reducing sugar at 31.23 mg/mL.
FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL Puspitaningrum, Rini; Amelia, Ria; Adisyahputra, Adisyahputra
Bioma Vol. 13 No. 1 (2017): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (497.512 KB) | DOI: 10.21009/Bioma13(1).4

Abstract

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.
PERKECAMBAHAN 4 AKSESI JEWAWUT (Setaria italica (L.) P. Beauv) PADA KONDISI CEKAMAN KEKERINGAN ARTIFISIAL Mapikasari, Septiani; Adisyahputra, Adisyahputra; Indrayanti, Reni
Bioma Vol. 13 No. 1 (2017): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (510.192 KB) | DOI: 10.21009/Bioma13(1).6

Abstract

Developing of jewawut cultivation as an alternative source of carbohydrates is one of the efforts to prevent food insecurity. Drought conditions and the availability of drought-tolerant seeds became one of the problems in the development of jewawut cultivation. The purpose of these experiments were to evaluate jewawut response to drought stress simulations at germination phases and to obtain accessions tolerant to drought stress. Drought stress is performed indirectly (PEG 6000 selective media). The research was done in Laboratory of Physiology of Faculty of Mathematic and Science, UNJ from February until July 2017. The experiments were done with a completely randomized design. Parameters of germination were analyzed with Anova test and continued by Duncan Multiple Range Test (DMRT). Lethal doses of PEG reducing 50% of germination (LD50) were 23,25%, with the quadratic equation y = 1,12-2,72x. The results base on germination phase, Buru merah as drought tolerance accessions, Polman merah and Polman kuning as medium tolerance accession, and Buru kuning as susceptible accessions.
MULTIPLICATION AND ACCLIMATIZATION OF BANANA VARIANT CV. AMPYANG (Musa acuminata, AAA) PUTATIVE RESISTANCE TO FUSARIUM WILT Indrayanti, Reni; Yanti, Fitri; Adisyahputra, Adisyahputra; Dinarti, D; Sudarsono, Sudarsono
Bioma Vol. 14 No. 1 (2018): Bioma
Publisher : LPPM Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (393.564 KB) | DOI: 10.21009/Bioma14(1).3

Abstract

Abstract Plants resistance to Fusarium wilt can be developed by mutation breeding and in vitro selection techniques. The objectives of this research were to evaluated growth and development of banana plantlets cv. Ampyang (Musa acuminata, AAA) resistance to Fusarium wilt. The plant material used in this study was 9 (nine) code clones banana cv. Ampyang result from mutations induced by gamma irradiation (30, 45, and 50 Gy) and in vitro - in vivo selection, a collection of Plant Tissue Culture Laboratory Department of Biology UNJ. Plantlets multiplied for four months on Murashige and Skoog supplemented with2.25 mgL-1 Benzyl amino purine and 0.22 mgL-1 Thydiazuron and 0.175 mgL-1 Indole 3 acetyc-acid . Acclimatization and evaluation of plantlet growth and development in a greenhouse showed that percentage of survival rate of plantlet were ranging from 42.9 – 100%. There was phenotypic variation among those plantlet investigated in quantitative and qualitative character. Plantlet regenerated from clone A regenerated from gamma irradiation 30 Gy and after in vitro selection of Foc from isolate Medan showed significantly the highest number of leave and fresh weight. The less number of roots length and other phenotypic character were produced from clone B, D and F. All of the regenerated plantlets were successfully transferred into soil and they would be used to evaluate the existence of variants in a greenhouse. Keywords: phenotypic variation, induce mutation and in vitro selection, shoot multiplication, Foc isolates from Medan