cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota bandung,
Jawa barat
INDONESIA
Articles 497 Documents
The Effect of Methyl Eugenol Block Plus on Bactrocera dorsalis Complex Total Captured in Chili Plantation Agus Susanto; Wahyu Daradjat Natawigena; Luciana Djaya; Tohidin Tohidin; Fauza Saputra
Jurnal Biodjati Vol 6, No 1 (2021): May
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i1.9708

Abstract

Fruit flies (Bactrocera spp.) are an important pest for horticultural crops, especially fruits and vegetables. One of the most effective and eco-friendly methods to control male and female fruit flies is by usingtraps that use Methyl Eugenol (ME) block plus fruit essence as an attractant. The purposes of this research were to acquire the most effective formulation of ME Block plus fruit essence to catch the most male and female fruit flies on the chili plantation and to detremine the increase in total of fruit flies caught. This research started from December 2017 to January 2018 at Cibeureum Village, Sukamantri District, Ciamis Regency, West Java Province. The research was conducted using a randomized block design consisting of 8 treatments and 3 repetitions. The treatments consisted of adding fruit essence to the ME block: 2 ml of ME on cotton; 2 ml of ME block; 2 ml of ME block + 4 ml of mango essence; 2 ml of ME block + 4 ml of orange essence; 2 ml of ME block + 4 ml of guava essence; 2 ml of ME block + 4 ml of star fruit essence; 2 ml of ME block + 4 ml of chili essence; Antilat (Organic pesticide) as a comparison. The results showed that ME block plus fruit essence has increased the total of male fruit flies caught, but it did not attract female fruit flies. The best combinations with the highest average of male fruit flies caught were ME block plus orange essence with 750.67/5 week, followed by ME block plus chili essence with 746.00/5 week
The Diversity and Conservation Status of Snakes in Rawa Mekar Jaya, Riau, Indonesia Agung Purnomo Adjie; Sri Catur Setyawatiningsih
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.9462

Abstract

Snakes in Mekar Jaya mangrove ecosystem have the potential be ecotourism objects. On the other hand ecotourism activities might reduce the quality of wildlife habitat, including that of the snake. This study aimed to determine the diversity and status of snake species in the mangrove ecosystem of Rawa Mekar Jaya. A transect of 20 x 50 m was made in three stations: rivers (S1), ecotourism route (S2), and dense mangroves (S3). The observation was carried out at low tide and repeated three times with a span of 2 days. Snake data was collected using the Visual Encounter Survey (VES) method. We revealed 59 snakes in the mangrove area of Rawa Mekar Jaya consisting of 3 species namely Boiga dendrophila, Cerberus rynchops, and Trimeresurus purpureomaculatus. B. dendrophila and C. rhyncops are mangrove specialists. The Shannon Wiener diversity index value (H ') for all observation stations is below one, so it is classified as low. All types of snakes found are not protected and classified as the least concern. C. rynchops is included in the CITES appendix III
Nocturnal Coleoptera and Hemiptera Diversity at Giam Siak Kecil Bukit Batu Biosphere Reserve Indonesia Hasni Ruslan; Imran S. L. Tobing
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.14102

Abstract

Giam Siak Kecil Bukit Batu is a biosphere reserve which one of its functions is as a habitat for wildlife. However, biodiversity data in the Giam Siak Kecil Bukit Batu Biosphere Reserve (GSKBB-BR) is still very minimal, including insects (Coleoptera and Hemiptera). This research was conducted to determine the diversity of Coleoptera and Hemiptera in the GSKBB Biosphere Reserve, Riau, Indonesia. The research was carried out using an exploratory method using "lights trap". The results of the study found 30 species, from 11 families of the order Coleoptera (23 species) and Hemiptera (7 species) in the GSKBB-BR. The diversity index of Coleoptera and Hemiptera at the observation site was moderate (H = 2.73), with a high evenness index (0.80). Scarabaeidae (order Coleoptera) is the family with the highest number of species found (8 species), while the most abundant species were Tibicen linnei and Pomponia fusca (Cicadidae/Hemiptera). Based on their functional roles, Coleoptera and Hemiptera with the highest number are herbivores (17 species), followed by predators (7 species) and decomposers (3 species). The range of values for temperature and humidity at the research site are in normal conditions. The GSKBB-BR area is an important remaining habitat for wildlife in Riau, including various types of insects (Coleoptera and Hemiptera); whose potential still needs to be revealed, and must be managed properly.
The Physiological Responses of Zea Mays L. and Cucumis Sativus L. on Drought Stress and Re-Watering Selis Meriem; Evi Muliyah; Melisnawati H. Angio; Triadiati Triadiati
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.12572

Abstract

Drought leads to deficit water availability and its detrimental effects seriously threaten plant growth. This study assessed the physiological, biochemical, and antioxidant adjustments in different types of photosynthetic plants between Zea mays L. (C4) and Cucumis sativus L. (C3 plant) under response to short-term drought stress. Analyses of relative water content (RWC), proline, and ascorbic acid (AsA) were performed to explore how these plants react to drought. Fifteen-day-old plants were subjected to full irrigation or gradual drought periods for 2-d, 4-d, 6-d, and 8-d following by recovery for 7-d. The results revealed that drought significantly reduces leaf RCW in both plants. Re-watered Z. mays after 8-d drought was higher than C. sativus and reestablished RCW by 23% of stressed plant although remained lower by 9% of the well-watered plant. While, proline and AsA contents in Z. mays were higher than those in C. sativus in drought treatment at 8-d (2.05 µmol/g FW) and 6-d (3174.60 AsA/100 g FW), respectively, that could demonstrate osmotic adjustment ability in this C4 species. The increased proline in both plants also indicates a good strategy for plants to recover. Rewatering gave a decrease AsA and could be expected that plants restore cellular activity after oxidative injury. Based on our study, proline is the most informative biochemical marker to differentiate plant response to drought and Z. mays adjusted defense mechanism to drought rather than C. sativus due to higher accumulation of proline, better antioxidant activity, and improved RCW after recovery.
Characterization of Plant Growth Promoting Rhizobacteria (PGPR) on Capcissum annum Indah Juwita Sari; Indria Wahyuni; Rida Oktorida Khastini; Ewi Awaliyati; Andriana Susilowati; Enggar Utari; I Nyoman Pugeg Aryantha
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13191

Abstract

Plant Growth Promoting Bacteria Rhizobacteria (PGPR) is one of the potential bacteria to enhance of Capsicum annuum through inhabitation the growth of pathogenic fungi. This study aimed to characterize PGPR in chili plants (Capsicum annuum). PGPR was isolated from the soil habitat of the red chili plant in Cilegon, Indonesia. Screening was then carried out with the dual culture method on Petri dishes and tested through in vivo method on the red chili plant. The selected bacteria were characterized morphologically, biochemically, and physiologically. The results revealed that there were 14 single isolates of bacteria from the roots of the red chili plants. The five single bacterial isolates, namely Azostobacter, Azospirillum, Pseudomonas, Serratia, and Beijerinckia have good potential as PGPR based on multiple culture screening by producing clear zones and positively effect the growth of chili plants.
Antibiotic Resistance in Escherichia coli Isolated from Feces of Bali Cattle With Reproductive Disorders Kholik Kholik; Muhammad Munawaroh; Muhammad Rama Imam Saputra; Rahmawati Rahmawati; Pudji Srianto
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13925

Abstract

Antimicrobial resistance (AMR) has become a global issue in animal, human and environmental health. The AMR profile of Escherichia coli reflects the use of antibiotics in production animals. The purpose of this study was to determine the antibiotic resistance of Escherichia coli bacteria isolated from the feces of female Bali cattle with reproductive disorders. Feces samples were taken purposively using a swab on 4 rectums from 7 Bali cattle with reproductive disorders in June 2021 in Lando Village, East Lombok Regency. Escherichia coli samples were isolated on Eosin Methylene Blue Agar media and identified by biochemical tests. An antibiotic resistance test against Escherichia coli was carried out by the disk diffusion method. The antibiotics used in the test were Penicillin G 10 U, Oxytetracycline 30 g, Gentamicin 10 g, and Tetracycline 30 g, and Cefotaxime 30 g. The results of planting on Eosin Methylene Blue Agar media obtained 4 Escherichia coli which were successfully isolated from 4 samples of Bali cattle feces. Data on the level of Escherichia coli susceptibility level to various antibiotics were analyzed using the chi-square test. The results of the susceptibility test to antibiotics showed that 4 samples of Escherichia coli (100%) were resistant to Penicillin G, (25%) were resistant to Oxytetracycline, (25%) were resistant to Cefotaxime, and (100%) samples of Escherichia coli were sensitive to Gentamicin and Tetracycline. The chi-square test on the level of Escherichia coli susceptibility to various antibiotics was significant with p˂ 0.05 (p-value = 0.012). The results of this study have shown that Escherichia coli from Bali cattle feces experience multidrug resistance which later on might have an impact on human health and the environment.
Genetic Profiling of Sida rhombifolia Originated from Several Indonesian Ethnicities Based on Sequence-Related Amplified Polymorphism Markers Jumailatus Solihah; Isma Kurniatanty; Dyah Subositi; Anshary Maruzy; Ika Nugraheny Ari Martiwi; Erny Qurrotul Ainy; Khoirul Anam; Aslikh Lana Dina
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.14553

Abstract

Sida rhombifolia is one of wild flowering plants that grows easily in many habitats with moderate humidity, with some usefulness in traditional medicine. Genetic characterization of Sida rhombifolia accessions originated from 12 ethnicities of Indonesia was analyzed based on Sequence-Related Amplified Polymorphism (SRAP) Markers. The genomic DNA were extracted from leaf samples and then were characterized by using the SRAP marker system according to Li and Quiros (2001). Nine pairs of SRAP primer resulted high polymorphic bands and were used in the genetic profiling. The data analysis was performed using GenAlEx to calculate genetic distance, Principal coordinate analysis, and Analysis of Molecular Variance (AMOVA), also using POPGENE to assess genetic diversity (Hs and Ht) and Nm to predict gene flow among populations. The coordinate analysis showed that the accessions originated from ethnicities along Wallacean line tend to differ genetically from most other locations. However, the results of analysis of molecular variance suggested that there were only slight differences (0.1%) found between ethnicities, while most genetic variances (99.9%) were found mostly among accessions within populations. The results suggested that there was an extensive genetic flow and plant spreading among Sida rhombifolia plant populations, resulting more homogenous genetic characters among most populations, while high diversity within population. The calculation of the number of migration (Nm = 1.7341) confirmed that the high rate of gene flow had occurred between populations.
Habitat Preference Modeling of Prehistoric Giant Shark Megalodon During Miocene in Bentang Formation of West Java Coast Andriwibowo Andriwibowo; Adi Basukriadi; Erwin Nurdin; Muh Aydava Mubarok
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.14115

Abstract

In the Miocene era about 20 million years ago, the South Coast of West Java was a sea and habitat for marine organisms including giant sharks Megalodon measuring about 18 meters long. This study aimed to model the habitat preference of the prehistoric gigantic shark Otodus megalodon population based on the fossil record. From fossil teeth, it revealed that the rock layer where the teeth found was Bentang formation from Miocene era. Many fossils of Megalodon had been unearthed from Bentang formation which is part of the South Coast of West Java. The habitat model was developed using the Sea Level Rise Inundation Tool of ArcGIS to estimate the sea depth and Megalodon’s habitat during the Miocene. The length of the teeth of O. megalodon found was ranged from 13 to 19 cm, indicating the presence of juvenile and adult O. megalodon. Based on the model, in the Miocene era, half of West Java was a sea with a depth ranging from 0 to 200 meters. At that time, it was estimated that juvenile O. megalodon occupied waters with a depth of 0-40 meters with an area of 1365 km2. Meanwhile, adult O. megalodon prefers a depth of 80-160 m and the frequency of habitat use increases at a depth of 200 m. The declining population of O. megalodon is associated with climate change and declining prey populations.
Diversity of Land and Freshwater Snail (Mollusca: Gastropoda) of Laiwangi Wanggameti National Park, Sumba Island, Indonesia Nova Mujiono; Nur Rohmatin Isnaningsih
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13521

Abstract

A study on the malacofauna of Laiwangi Wanggameti National Park (LWNP) in Sumba Island has been conducted. This study aims were to reveal the diversity of malacofauna in Sumba and compare it with those in the Lesser Sunda Islands. Observations were made on 20 stations using plots (10 x 10 m) in Wanggameti and Laiwangi. Specimens were collected for two hours in each plot. Twenty families and 44 species have been identified. The overall number of species from Sumba increased from 126 to 143 species. The LWNP represents 31% diversity of malacofauna in Sumba Island. Seventeen species are considered as new records for the island. Five endemic land snail species are still observed inside the park. The diversity and population density tend to be higher in Laiwangi area with lower altitudes than in Wanggameti area with higher altitudes. Two dominant species are Asperitas bimaensis cochlostyloides and Tarebia granifera. Species composition in Sumba is more similar to Bali compared with the other six neighboring islands.
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Denia Dwi Citra Resmi; Topik Hidayat; Siti Sriyati
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.