cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Rolan Rusli
Contact Email
admin@jurnalfamul.com
Phone
+6282154639509
Journal Mail Official
admin@jurnalfamul.com
Editorial Address
Gedung Administrasi Fakultas Farmasi Universitas Mulawarman, Jalan Penajam, Kampus UNMUL Gn. Kelua, Samarinda, 75119. Indonesia
Location
Kota samarinda,
Kalimantan timur
INDONESIA
Journal of Tropical Pharmacy and Chemistry
Published by Universitas Mulawarman
ISSN : 20877099     EISSN : 24076090     DOI : 10.25026/jtpc
Core Subject : Health, Science,
Biochemistry, Genetics & Molecular Biology Chemistry Health Professions Immunology & microbiology Medicine & Pharmacology
Journal of Tropical Pharmacy and Chemistry is a Six monthly (June and December), international, open access, journal dedicated to various disciplines of pharmaceutical and allied sciences. Journal of Tropical Pharmacy and Chemistry publishes manuscripts (Original research Article, review articles, Mini-reviews, and Short communication) on original work, either experimental or theoretical in the following areas: Pharmaceutics & Biopharmaceutics, Novel &Targeted Drug Delivery, Nanotechnology & Nanomedicine, Pharmaceutical Chemistry, Pharmacognosy & Ethnobotany, Phytochemistry, Pharmacology & Toxicology, Pharmaceutical Biotechnology & Microbiology, Pharmacy practice & Hospital Pharmacy, Pharmacogenomics, Pharmacovigilance, Natural Product Research, Drug Regulatory Affairs, Case Study & Full clinical trials, Biomaterials & Bioactive polymers, Analytical Chemistry, Organic Chemistry, Physical Pharmacy, Clinical Pharmacy.
Arjuna Subject : Pharmacology, Toxicology and Pharmaceutics - Ilmu Farmasi
Articles 298 Documents
 20   21   22   23   24 
Quality Test of Extemporaneously Prepared Tramadol and Paracetamol Capsules Combination Derived From a Private Hospital in Semarang Paulus Unggul Wikan Prabandono; Michael Raharja Gani; Sri Hartati Yuliani
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 4 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i4.287

Abstract

Tramadol and paracetamol are analgesic drugs that are often combined and made in the form of extemporaneously prepared capsules dosage form to treat moderate to severe pain management. This study aims to determine the quality of prescribed medication of extemporaneously prepared tramadol and paracetamol capsules combination taken from a private hospital in Semarang covering weight uniformity, moisture content, disintegration, and content uniformity. This type of research is a descriptive observational cross-sectional design. Samples were taken using simple random sampling at a pharmaceutical installation in a private hospital in Semarang. The observation result from four types of testing was compared against the standard values of each test’s parameter listed in the Indonesian Pharmacopoeia V. The results are, samples meet the weight uniformity test with an acceptance value of 7.34%; meet the moisture content test with an average moisture content of 2.647% for the first day and 3.04% for the seventh day; meet the disintegration test with a breakdown time of fewer than 15 minutes; and did not meet the uniformity test with acceptance value of 34.06% for paracetamol and 34.30% for tramadol. It can be concluded that the prescribed medication of extemporaneously prepared capsule samples derived from a private hospital in Semarang can fulfill the standard values listed in the Indonesian Pharmacopoeia V except for the content uniformity test.
Nephrotoxicity Risk of Cyclophosphamide in Lupus Model Niken Indriyanti
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.289

Abstract

Cyclophosphamide is one of the standard therapies for lupus, especially lupus nephritis based on its immunosuppressive effect. However, cyclophosphamide is also known as a nephrotoxic agent. Therefore, this research was aimed to measure the effect of cyclophosphamide at the dose that comparable to the human dose of 1 mg/kg BW on the kidney of lupus mice induced by means of 2,6,10,14-tetramethylpentadecane (TMPD). In this research, the IL-6 as a pro-inflammatory cytokine was tested by using flow cytometry method. In addition, the structural damage of the kidney tissues was assessed by means of Moroni’s kidney organ scoring method for lupus. The result showed that cyclophosphamide reduced the IL-6 significantly with the value of 36.72±22.79% for the TMPD-treated group; 32.59±9.97% for the cyclophosphamide group; and 30.25±4.48% for the naïve group. Moreover, the damages of the kidney tissues on the cyclophosphamide group were more severe than the TMPD-treated group. In conclusion, despite its anti-inflammatory effect which is useful for lupus, cyclophosphamide has a severe nephrotoxic effect which harms the patient. The effects may be a cause of the long interval use of cyclophosphamide. It can be a consideration for the further research and the next revision of the guideline for lupus nephritis treatment.
Effectiveness of Antiviral Drugs as Covid-19 Therapy Adelia Firandi; Didik Hasmono
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.291

Abstract

Introduction: SARS-CoV 2 firstly emerged in China on December 2019 and it was spreading rapidly across the world until now. At this time, there is no vaccine or medication approved by the FDA. However, there are some FDA approved medicines for treating other diseases that can be used for Covid-19 based on tests. This review focuses on therapy efficacy, work mechanism, pharmacokinetic profile, safety, and future perspective. Method: Article review related to therapy on Covid-19 patients, particularly antiviral therapy which was the combination of lopinavir and ritonavir, chloroquine, hydroxychloroquine, remdesivir, and favipiravir. The reviewed relevant articles were observational study, in vitro test, case report, and clinical test. Results: A total of 13 articles met the requirement, 9 articles discussed the result of therapy during the medication of COVID-19 patients, 2 reports of in vitro test, and 2 results of clinical trials. Conclusion: From several studies that had been conducted, remdesivir, combination of lopinavir and ritonavir, as well as favipiravir showed benefits in various clinical studies on Covid-19 patients. Meanwhile, chloroquine and hydroxychloroquine showed limited effects and did not affect the decrease of mortality.
Proximate Composition, In vitro Antioxidant and Anti-inflammatory Properties of Adansonia digitata and Belanites aegyptiaca Seeds Mercy Badu; Mary-Magdalene Pedavoah; Nathaniel O Boadi; Irene Y Dzaye
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 4 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i4.296

Abstract

This study evaluated the nutritional and medicinal properties of seeds from Adansonia digitata (BSF) and Balanite aegyptiaca (DDSF) plant. Proximate chemical composition, mineral elements composition, flavonoids, phenolics, antioxidant capacity, and anti-inflammatory properties were studied. Results obtained revealed that DDSF had the highest moisture, crude fat and crude protein content of 7.66 %, 42.80 %, 20.37 % respectively, whilst BSF gave the highest ash, crude fibre and carbohydrate content. Elemental analysis revealed BSF had the highest Mg content (313.65 mg/100g) and DDSF gave the highest Ca content (118.62 mg/100g). Additionally, DDSF gave the highest total phenolics (18.89 mg TAE/ 100 g), total flavonoids (8.80 mg QE/ 100 g) as well as the highest total antioxidant capacity of (19.62 mg AAE/ 100 g) dry of extract. Based on results obtained in this study, seeds obtained from the Adansonia digitata and Balanite aegyptiaca could be a potential source of functional food and antioxidant agents.
Primer Design and Analysis for Detection of mecA gene Armini Syamsidi; Nuur Aanisah; Reyhan Fiqram; Imanuel Al Jultri
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.297

Abstract

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ?3, stability ?1,2, secondary structure >-16 Kcal/mol, runs ?5, repeats ?4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method
Activity of Tokulo (Kleinhovia hospita L.) as Anti Rheumatoid Arthritis and Anti-inflammatory in White Rats Induced by Complete Freud Adjuvant (CFA) Fatma Sari Siharis; Selpirahmawati Saranani; Nurlansi Nurlansi
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.299

Abstract

Tokulo (Kleinhovia hospita) leaves are commonly used by Moronene people (Southeast Sulawesi) to treat headaches. This is supported scientifically from research which states that tokulo leaves have analgesic and anti-inflammatory activity. The NSAID group is included in the anti-rheumatoid arthritis therapy. To determine the anti-RA activity of this plant, a study was carried out on CFA-induced rats. Based on the results of the study, it is known that the ethanol extract of tokulo leaves has anti-RA and anti-inflammatory activity in CFA-induced rats. Keywords: Kleinhovia hospita, Rheumatoid Arthritis, Inflammation
Determination of Polyphenol Content in Sawo Fruit (Manilkara zapota) Based on Geographical Location Harni Sartika Kamaruddin; Angriani Angriani; Carla Wulandari Sabandar
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.300

Abstract

Background: Sawo fruit (Manilkara zapota (L.) P.Royen) is rich in antioxidant compounds like polyphenols, and has long been used to treat diarrhea and thypoid by natives of Toari and Langori villages of Kolaka district of Southeast Sulawesi Province. Both villages located at different geographical location according to their altitudes from the sea level. The polyphenols content of sawo fruit from these villages that has a correlation with its antioxidant activity has yet investigated and thus need more research. Objective: This study was aimed to determine the content of polyphenols in sawo fruit based on geographical growth difference, that are Toari and Langori villages. Material and Methods: The fruits were collected from two locations of the Kolaka district that are Langori and Toari villages. The polyphenols content in the methanol extract of Sawo fruit was determined qualitatively using FeCl3 and quantitatively using the Folin-Ciocalteu reagent measured by UV-Visible spectrophotometry. Gallic acid was used as the standard polyphenol of the assay. Results: The polyphenols content of sawo fruit from Langori found to be 1.48113 mg/g, while fruits from Toari contained 1.55747 mg/g of polyphenolics. Conclusion: The study showed that there was an influence of the geographical growth on the content of polyphenolics of sawo fruits.
Impact of Halal Information on Purchasing Decisions moderated Religiosity in Food and Beverage Provision Junaidin Junaidin; Syarifah Hudaya; Laode Rijai; Tetra Hidayat; Djoko Setyadi
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.304

Abstract

Halal information on Food and Beverage Preparations, analyze for influence on Purchasing Decisions. Novelty research is the Role of Moderation to the relationship of Halal Information to Purchasing Decisions. Using structural model equations (SEM), there is a positive and significant impact of Halal Information on Purchasing Decisions. There is a positive and considerable moderation of Religiosity to the relationship between Halal Information and Purchasing Decisions. The practical implications of the study's results, empirically proving that Halal Information listed on Food and Beverage Preparations led to an increase in Purchasing Decisions, and consumer Religiosity showed significant differences. Advice for Food and Beverage manufacturers to keep halal information on Food and Beverage Preparations because it affects positive buying decisions.
Physical Evaluation of Transfersome that Contains Pandan Leaves Extract (Pandanus amaryllifolius R.) Rini Ambarwati; Yulianita Yulianita
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 4 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i4.307

Abstract

Pandan leaves have been researched and have effectiveness in the treatment of burns. The process of healing burns takes a long time and cause a hard tissue because it loses its elasticity, making it difficult to penetrate. In this study, pandanus leaves were formulated into the nanovesicle carrier system, namely trasfersom. Transfersomes have the ability to deform, namely the ability to reduce the particle size 5-10 times from the original size when passing through the gaps between cells so that transfersom can increase the penetration of active substances. The three formulas used are based on the ratio of concentrations of trasfersome vesicles, namely phospholipids and span 80. Formula 1 is (90:10), Formula 2 (85:15) and Formula 3 (80:20). The best formula is determined based on transfersom characterization, including particle size and PDI (solidispersity index), zeta potential, entrapment efficiency, deformability, and TEM particle morphology. The results showed that Formula 3 (80:20) is the most stable formula with an average particle size of 730.1 ± 4.9 nm, PDI value <0.7, zeta potential - 9.94 ± 1.02 mV, efficiency absorption 80.23%, and the deformability value 6.225.
Spectrophotometric Methods for the Determination of Caffeine in Beverages Use Solvent Extraction Techniques and Adsorption of Activated Carbon Edy Agustian Yazid; Abdul Wafi; Agustin Eka Wulandari
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 4 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i4.308

Abstract

Kafein memiliki kegunaan terapeutik yang luas, banyak digunakan di bidang farmasi sebagai analgesik, dan mengurangi demam. Kafein juga banyak ditambahkan sebagai zat penyedap pada minuman ringan seperti coca cola dan minuman energi. Konsumsi kafein yang berlebihan atau dalam jangka panjang dapat berdampak negatif bagi kesehatan. Kandungan kafein dalam minuman bervariasi menurut mereknya, dari 10 hingga 50 mg per porsi. Penelitian ini bertujuan untuk mengetahui jumlah kafein dalam minuman berkarbonasi dan minuman energi dengan menggunakan teknik ekstraksi pelarut kloroform dan teknik adsorpsi karbon aktif. Kadar kafein dalam minuman dianalisis dengan metode spektrofotometri menggunakan panjang gelombang maksimum. Hasil penelitian menunjukkan bahwa jumlah kafein dengan teknik ekstraksi pada minuman coca cola adalah (31,39 ± 0,528 mg / saji), pepsi biru (27,93 ± 0,159 mg / sajian), banteng merah (39. 79 ± 0,233 mg / porsi), dan macan kumbang (43,37 ± 0,860 mg / porsi). Teknik adsorpsi yang diperoleh pada minuman coca cola adalah (32,07 ± 0,164 mg / saji), pepsi biru (27,42 ± 0,174 mg / saji), banteng merah (31,35 ± 0,132 mg / saji), dan macan kumbang (33,83 ± 0,205 mg / saji) . Pada minuman coca cola, diperoleh hasil terbaik mendekati nilai sebenarnya seperti yang tertera pada label. Sedangkan untuk ketiga jenis minuman lainnya, jumlah kafein yang didapat lebih rendah dari yang diharapkan, dan masih di bawah batas maksimal yang diperbolehkan. Dari dua teknik yang diteliti, teknik ekstraksi masih memberikan hasil yang lebih baik dibandingkan dengan teknik adsorpsi. dan macan kumbang (33,83 ± 0,205 mg / porsi). Pada minuman coca cola, diperoleh hasil terbaik mendekati nilai sebenarnya seperti yang tertera pada label. Sedangkan untuk ketiga jenis minuman lainnya, jumlah kafein yang didapat lebih rendah dari yang diharapkan, dan masih di bawah batas maksimal yang diperbolehkan. Dari dua teknik yang diteliti, teknik ekstraksi masih memberikan hasil yang lebih baik dibandingkan dengan teknik adsorpsi. dan macan kumbang (33,83 ± 0,205 mg / porsi). Pada minuman coca cola, diperoleh hasil terbaik mendekati nilai sebenarnya seperti yang tertera pada label. Sedangkan untuk ketiga jenis minuman lainnya, jumlah kafein yang didapat lebih rendah dari yang diharapkan, dan masih di bawah batas maksimal yang diperbolehkan. Dari dua teknik yang diteliti, teknik ekstraksi masih memberikan hasil yang lebih baik dibandingkan dengan teknik adsorpsi. Kata kunci : Kafein, Minuman, Ekstraksi, Adsorpsi, Spektrofotometri

Page 22 of 30 | Total Record : 298

 20   21   22   23   24 

Filter by Year

2010 2025


Reset
Filter By Issues
All Issue Vol. 9 No. 2 (2025): J. Trop. Pharm. Chem. Vol. 9 No. 1 (2025): J. Trop. Pharm. Chem. Vol. 8 No. 2 (2024): J. Trop. Pharm. Chem. Vol. 8 No. 1 (2024): J. Trop. Pharm. Chem. Vol. 7 No. 2 (2023): J. Trop. Pharm. Chem. Vol. 7 No. 1 (2023): J. Trop. Pharm. Chem. Vol. 6 No. 2 (2022): J. Trop. Pharm. Chem. Vol. 6 No. 1 (2022): J. Trop. Pharm. Chem. Vol. 5 No. 4 (2021): J. Trop. Pharm. Chem. Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem. Vol. 5 No. 2 (2020): J. Trop. Pharm. Chem. Vol. 5 No. 1 (2020): J. Trop. Pharm. Chem. Vol. 4 No. 6 (2019): J. Trop. Pharm. Chem. Vol. 4 No. 5 (2019): J. Trop. Pharm. Chem. Vol. 4 No. 4 (2018): J. Trop. Pharm. Chem. Vol. 4 No. 3 (2018): J. Trop. Pharm. Chem. Vol. 4 No. 2 (2017): J. Trop. Pharm. Chem. Vol. 4 No. 1 (2017): J. Trop. Pharm. Chem. Vol. 3 No. 4 (2016): J. Trop. Pharm. Chem. Vol. 3 No. 3 (2016): J. Trop. Pharm. Chem. Vol. 3 No. 2 (2015): J. Trop. Pharm. Chem. Vol. 3 No. 1 (2015): J. Trop. Pharm. Chem. Vol. 2 No. 5 (2014): J. Trop. Pharm. Chem. Vol. 2 No. 4 (2014): J. Trop. Pharm. Chem. Vol. 2 No. 3 (2013): J. Trop. Pharm. Chem. Vol. 2 No. 2 (2013): J. Trop. Pharm. Chem. Vol. 2 No. 1 (2012): J. Trop. Pharm. Chem. Vol. 1 No. 4 (2012): J. Trop. Pharm. Chem. Vol. 1 No. 3 (2011): J. Trop. Pharm. Chem. Vol. 1 No. 2 (2011): J. Trop. Pharm. Chem. Vol. 1 No. 1 (2010): J. Trop. Pharm. Chem. More Issue