Claim Missing Document
Check
Articles

Found 18 Documents
Search

PENENTUAN NILAI SPF (SUN PROTECTING FACTOR) EKSTRAK N-HEKSAN ETANOL DARI RICE BRAN (ORYZA SATIVA) SECARA IN VITRO DENGAN METODE SPEKTROFOTOMETRI UV-VIS Mulyani, Mulyani; Syamsidi, Armini; Putri, Pramita
Natural Science: Journal of Science and Technology Vol 4, No 1 (2015): Volume 4 Number 1 (March 2015)
Publisher : Univ. Tadulako

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (371.483 KB)

Abstract

Sinar matahari merupakan sumber energy bagi kelangsungan hidup semua makhluk di bumi, namun pada paparan berlebih di kulit akan memberikan derajat kerusakan yang tergantung pada frekuensi dan lamanya sinar matahari mengenai kulit. Kemampuan menahan sinar ultraviolet dari sediaan tabir surya dinilai sebagai factor proteksi sinar (Sun Protecting Factor/SPF). Penelitian ini bertujuan untuk menentukan SPF (Sun Protection Factor) dari ekstrak n-Heksan etanol bekatul (Oryza sativa) dengan menggunakan metode spektrofotometri. Bekatul diekstraksi dengan metode soxhlethasi menggunakan larutan penyari n-Heksanetanol, kemudian dibuat seri konsentrasi larutan sampel 100 ppm, 150 ppm, 200 ppm, 250 ppm, dan 300 ppm dengan pelarut etanol absolut. Larutan tersebut selanjutnya diukur absorbansinya pada spektrofotometer UV-Vis dengan panjang gelombang 280-400 nm. Hasil penelitian menunjukkan bahwa ekstrak n-Heksanetanol bekatul dapat efektif memberikan perlindungan pada sinar UV-B. Nilai SPF yang diperoleh mulai dari konsentrasi 200 ppm, dengan nilai SPF sebesar 2,355, selanjutnya pada konsentrasi 250 ppm sebesar2,884 dan pada konsentrasi 300 ppm sebesar 3,483.
PENGARUH VARIASI EKSTRAK METANOL KULIT BUAH RAMBUTAN (NEPHELIUM LAPPACEUM L.) TERHADAP KESTABILAN FISIK KRIM ANTIOKSIDAN Syamsidi, Armini
Natural Science: Journal of Science and Technology Vol 3, No 2 (2014): Volume 3 Number 2 (August 2014)
Publisher : Univ. Tadulako

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (245.786 KB)

Abstract

ABSTRACT A research on influence methanol extracts concentration of fruit peel rambutan (N. lappaceum L.), concerning physical stability of creams antioxidant had been done. This research aims to obtain an antioxidant cream formulation O/W type from rambutan fruit peel extracts and compares activity of the antioxidant cream with extract from fruit peel rambutan with using free radical 2,2-diphenyl-1-picrylhydrazyl (DPPH) scavenging activity. A total of 500 grams of fruit rambutan peel extracted with 80% methanol by maceration method and then extract obtained made antioxidant cream O/W type with the variation of the concentration of extract 1%, 2%, and 3% to the total weight of the cream. Evaluation of physical stability of creams includes organoleptic testing, creaming, viscosity testing and drop size of dispersed phase inversion before and after the storage conditions during the 12-hour accelerated alternately at 5°C and as many as 10 cycles of 35°C. Organoleptic observations show no change in color and odor on the third-cream formula. The research was used a completely randomized design and the data obtained were analyzed statistically distinguished by ansira on the confidence level. Statistical analysis shows that the concentration of rambutan fruit peel extracts give significant effect on the viscosity cream before and after accelerated storage conditions, while the size of the drops dispersed showed no significant effect. In this study, showed that no phase of inversion and creaming from all of cream. Formulation of skin creams with methanol extract of the fruit rambutan 1% cream can be categorized as the most stable, continuing antioxidant activity test showed that the cream with a concentration of extract 12,359 ppm, which inhibits 50% of free radicals.
Overproduction, Purification and Refolding of codon-optimized Hepatitis B Virus X Protein Subgenotype B3 in Escherichia coli BL21(DE3) Anita Artarini; Armini Syamsidi; Anindyajati Anindyajati; Raymond R. Tjandrawinata; Debbie S. Retnoningrum
HAYATI Journal of Biosciences Vol. 29 No. 2 (2022): March 2022
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.29.2.164-170

Abstract

Hepatitis B virus (HBV) infects human and causes chronic liver infection, leading to liver cirrhosis and hepatocellular carcinoma. HBV X (Hbx) protein is known to interact with tumor suppressor protein p53 and block its translocation into the nucleus. This study outlines the overproduction of Hbx protein from HBV subgenotype B3 in Escherichia coli BL21(DE3), including its purification and refolding. The gene encoding Hbx was first codon-optimized and inserted into pET16b. The recombinant plasmid was then transformed into E. coli BL21(DE3) as an expression host. Optimization of Hbx expression was performed with variation of IPTG concentration and overproduction temperature. The results showed that Hbx protein was optimally induced by 0.075 mM IPTG and overproduction of Hbx at 17, 25, and 37°C exhibited no difference in protein level and location. The optimal refolding of Hbx was obtained using 0.1 M arginine prior to elution from Nickel column using 100 mM imidazole and 0.25 M arginine. Hbx migrates differently in SDS-PAGE reducing and non-reducing, while the melting curve pattern in TSA analysis changed after the refolding step. Essentially, this purified Hbx protein could potentially be used for interaction study with p53 and the inhibitor candidate of the protein.
Isolation of endophytic fungi from benalu batu (Begonia medicinalis) and their toxicity on Artemia Salina Syariful Anam; Armini Syamsidi; Musyahidah Musyahidah; Nurul Ambianti; Agustinus Widodo; Muhammad Sulaiman Zubair
Jurnal Ilmiah Farmasi 2022: Special Issue
Publisher : Universitas Islam Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20885/jif.specialissue2022.art3

Abstract

Abstract   Background: Endophytic fungi are microorganisms found in plant tissues that are mutually beneficial to the host plant. They are known as sources of bioactive metabolites which possess various biological activities such as antimicrobial, anticancer, antiviral, antifungal, and antioxidant.  Benalu batu (Begonia medicinalis) has been used empirically as a medicinal plant and has shown anticancer activity in breast cancer cells (T47D cells) and cervical cancer cells (HeLa cells).Objective: This study aimed to isolate the endophytic fungi from benalu batu and determine the toxicity activity and Lethal Concentration 50% (LC50) value of isolated endophytic fungi using shrimp larvae (Artemia salina). Method: Endophytic fungi were isolated from fresh parts; leaves, stems, roots of Benalu Batu. The selected parts were sterilized with ethanol 70% and sodium hypochlorite 1% subsequently placed into Potato Dextrose Agar Chloramphenicol (PDAC) then incubated at 28°C for 7 days. Isolated endophytic fungi were extracted by sonication method using ethyl acetate. The toxicity activity of isolated endophytic fungi was determined using the Brine Shrimp Lethality Test (BSLT).Results: Isolation of the endophytic fungi from benalu batu obtained 10 isolates, which the leaves part obtained 6 isolates, the stem obtained 3 isolates and the root obtained 1 isolate. The results of screening for toxicity test of 10 isolates at concentrations of 500 µg/mL shown that isolate D3, D5, and D6 gave 100% mortality. The LC50 values of isolate D3, D5, and D6 were obtained respectively in 448.03, 8.784, and 9.13 µg/mL.Conclusion: These results indicated that isolate D5 exhibits the greatest toxicity and needs to be investigated the activity for testing on cancer cells.Keywords: endophytic fungi, Begonia medicinalis, toxicity, Artemia salina Intisari  Latar belakang: Jamur endofit merupakan mikroorganisme yang terdapat dalam jaringan tumbuhan yang bersifat mutualisme terhadap tumbuhan inang. Jamur endofit telah diketahui sebagai sumber metabolit yang memiliki beberapa aktivitas biologi seperti antimikroba, antikanker, antivirus, antijamur, dan antioksidan. Tumbuhan benalu batu (B. medicinalis) telah digunakan secara empiris dan terbukti memiliki aktivitas antikanker pada sel kanker payudara (Sel T47D) dan sel kanker leher rahim (Sel HeLa). Tujuan: Studi ini bertujuan untuk melakukan isolasi jamur endofit dari benalu batu dan mengetahui toksisitas isolat jamur endofit serta menentukan nilai Lethal Concentration 50% (LC50) terhadap larva udang (Artemia salina)Metode: Jamur endofit diisolasi dari bagian segar; daun, batang, akar benalu batu. Bagian-bagian tersebut disterilisasi dengan etanol 70% dan natrium hipoklorit 1% selanjutnya diletakkan pada media Potato Dextrose Agar Chloramphenicol (PDAC) kemudian diinkubasi pada suhu 28°C selama 7 hari. Isolat jamur endofit diekstraksi dengan metode sonikasi menggunakan etil asetat. Aktivitas toksisitas isolat jamur endofit ditentukan menggunakan metode Brine Shrimp Lethality Test (BSLT).Hasil: Isolasi jamur endofit dari benalu batu diperoleh 10 isolat, bagian daun diperoleh 6 isolat, bagian batang diperoleh 3 isolat dan bagian akar diperoleh 1 isolat. Hasil penapisan uji toksisitas 10 isolat pada konsentrasi 500 µg/mL menunjukkan bahwa isolat D3, D5, dan D6 memberikan persentase mortalitas sebesar 100%. Nilai LC50 isolat D3, D5, dan D6 diperoleh masing-masing sebesar 448,03, 8,784, dan 9,13 µg/mL.Kesimpulan: Hasil ini menunjukkan isolat D5 memiliki toksisitas paling besar dan perlu dilanjutkan untuk pengujian pada sel kanker.Kata kunci : jamur endofit, Begonia medicinalis, toksisitas, Artemia salina
In-vitro Sun Protecting Factor of Rice Bran Oil and Its Formulation as Compact Powder Armini Syamsidi; Evi Sulastri; Yusriadi Yusriadi; Pramita Putri; Nuur Aanisah
Jurnal Sains Farmasi & Klinis Vol 10, No 1 (2023): J Sains Farm Klin 10(1), April 2023
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.10.1.54-61.2023

Abstract

This study aims to determine the effective concentration of rice bran oil which can protect against ultraviolet (UV) rays as well as formulate it in compact powder preparation followed by determination of its Sun Protecting Factor (SPF) value. Rice bran samples were extracted using the Soxhlet extraction method with n-hexane: ethanol (1:1) as the solvent. Further identification of the γ-oryzanol in rice bran oil was carried out using TLC silica gel GF254 with eluent of n-hexane:ethyl acetate (3:1). The obtained γ-oryzanol in rice bran oil was used as the ingredient to develop the compact powder which is made into five formulas with 0,05 %-0,25 % concentration. All formulas were characterized, including homogeneity, adhesion and crack test. UV-Visible spectrophotometry was used to determine the SPF value of rice bran oil and its compact powder. The identification results demonstrated a positive presence of the chemical γ-oryzanol in the rice bran oil. At concentrations of 500, 1000, 1500, 2000, and 2500 ppm, rice bran oil may protect against UV rays with SPF values ranging from 1.741 to 11.884. The result showed that all formulas dispersed homogeneously, performed well in terms of compactness, and had no breaks or cracks discovered. Meanwhile, the SPF values of all formulas are found to be 1.390 and 1.274. The results indicate that the SPF values are shallow and are included in the minimal SPF category (2-4) in protecting against UV rays.
Development and Evaluation of Microemulsion-Based Sunscreen Cream Containing Lycopene from Tomato (Solanum lycopersicum L.) Ritha Pratiwi; Nandiska Maladjili; Evi Sulastri; Yusriadi Yusriadi; Nuur Aanisah; Armini Syamsidi
Jurnal Farmasi Sains dan Komunitas (Journal of Pharmaceutical Sciences and Community) Vol 20, No 1 (2023)
Publisher : Sanata Dharma University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24071/jpsc.003807

Abstract

This study aimed to formulate and determine the sun protection factor (SPF) of sunscreen made from tomato lycopene microemulsion creams. Lycopene was used as the active ingredient with varying concentrations in each formula, namely F1 5%, F2 7.5%, and F3 9%. The preparation of each formula was evaluated by conducting the globule size, polydisperse index, organoleptic test, homogeneity test, pH test, spreadability test, viscosity test, and determination of SPF value. The average globule size was 119 nm which had a uniform size distribution. The physical characteristics test of the cream preparations showed the three had a bright yellow color and lacked odor. The pH test results were 3.2 ± 0.12, 5.54 ± 0.25, 6.48 ± 0.22 for F1, F2, F3, respectively. Viscosity test results were F1 40,893.33 cPs, F2 41,746.67 cPs, and F3 43,106.67 cPs. The values obtained from the dispersion test were F1 6.71±0.63, F2 5.58±0.15, and F3 4.81±0.11. Moreover, F3 with a concentration of 9% tomato lycopene microemulsion met the acceptance criteria for all of the physical properties including low viscosity to promote good spreadability, pH that does not irritate the skin, aesthetic appeal, small particle size, and non-odorous and an SPF value of 4.9. The obtained microemulsion-based sunscreen cream exhibited a good physical property of lycopene besides showing sufficient SPF value.
Standardization of Ethanol Extract of Dioscorea alata L. Variety of Paoateno from Banggai Islands District, Central Sulawesi: Standarisasi Ekstrak Etanol Dioscorea alata L. Varietas Paoateno Asal Kabupaten Banggai Kepulauan Sulawesi Tengah Ismail, Ihwan; Khumaidi, Akhmad; Putri, Ayu Dinawati; Primadia, Rizki; Syamsidi, Armini; Khaerati, Khildah
Jurnal Farmasi Galenika (Galenika Journal of Pharmacy) (e-Journal) Vol. 9 No. 2 (2023): (October 2023)
Publisher : Universitas Tadulako

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22487/j24428744.2023.v9.i2.16065

Abstract

Background: Standardizing herbal medicines is crucial for assessing their quality and effectiveness. Objectives: This study aims to determine non-specific and specific standardization parameters for medicinal plants. Non-specific parameters include drying shrinkage, water content, total ash content, acid insoluble ash content, total bacteria, total mold, and metal limits (Pb, Hg, and Cd). Specific parameters involve organoleptic examination, identification of chemical content in extracts, dissolved compounds in specific solvents, total flavonoid content, and qualitative testing of anthocyanin content in the extract. Materials and Methods: An experimental laboratory approach was employed to extract Dioscorea alata L using 96% ethanol, which was later concentrated through a rotary evaporator to obtain a viscous extract. Specific and non-specific parameters were determined using standardized techniques. Results: The extract yielded 3.32% of the initial substance. Drying shrinkage was 19.7769±1.2682%, and specific gravity was 0.6192±0.1476 gram/ml for 5% m/v and 0.5101±3.9591 gram/ml for 10% m/v. Ash content was 0.6793%, with acid insoluble ash content at 0.1895%. Heavy metal contamination for Hg was 0.47 ppm, but undetected for Pb & Cd). The total plate number was 27 x 103 colonies/g, and negative Escherichia coli contamination. The mold count was 39 x 101 colonies/g. Additional specific parameters included the organoleptic properties of the viscous extract (purple color, characteristic odor, and sweet taste), water-soluble compound content (15.63%), ethanol-soluble compound content (14.73%), and a flavonoid content of 76.669 mg EQ/100 mg. Conclusions: The ethanol extract of Dioscorea alata complies with the standard requirements established by the Food and Drug Supervisory Agency. It presents as a viscous extract with a distinct odor, purple-black color, and sweet taste. The extract contains alkaloids, flavonoids, saponins, tannins, steroids, and phenolic compounds, with a total flavonoid content of 76.669 mg. Furthermore, it tested positive for anthocyanins.
Isolation of Endophytic Fungi from Rui (Harrisonia perforata (Blanco) Merr.) and Determining Their Antibacterial, Antioxidant, and Cytotoxic Activity Anam, Syariful; Syamsidi, Armini; Tunreng, Muh. Fadil Usman; Djaleha, Helena Fransisca; Arisca, Windhy Nur; Syaputra, Gunawan; Iklima; Indriani, Meri Feki; Widodo, Agustinus; Pratiwi, Ritha; Yuliet; Razak, Abd. Rahman
HAYATI Journal of Biosciences Vol. 31 No. 3 (2024): May 2024
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.31.3.443-456

Abstract

Endophytic fungi produce bioactive metabolites that exhibit antibacterial, antioxidant, and anti-cancer activity. Rui (Harrisonia perforata (Blanco) Merr.) is a traditional medicinal plant proven to be an antibacterial and anticancer. Endophytic fungi live in plant tissues without damaging or producing chemicals that infect the host cell. Endophytes produce the same and similar compound as an original plant. This study aimed to isolate the endophytic fungi from Rui and determine their antibacterial, antioxidant, and cytotoxic activity. 13 fungal isolates were successfully isolated using PDA for seven days at 30°C. Molecular identification using the ITS1 and ITS4 DNA sequences only revealed six species: Diaporthe sp., Phomopsis sp., Aspergillus tubingensis, Aspergillus viridinutans, Pseudofusicoccum sp., and Daldinia eschscholtz. Seven isolates showed antibacterial activity based on plate assay. Aspergillus tubingensis and RA-1 exhibited antibacterial activity against Staphylococcus aureus and Salmonella typhi, with the MIC and MBC starting from 24 to 32 mg/ml. The DPPH assay showed the most increased antioxidant activity in Daldinia eschscholtzii with an IC50 of 98.14±2.39 µg/ml. The Brine Shrimp Lethality Test (BSLT) showed the highest potential cytotoxic activity, as shown by Aspergillus tubingensis and Phomopsis sp. with LC50 of 7.78±7.48 and 30.83±0.39 µg/ml. In conclusion, our study demonstrates that the fungal extract from Rui could be a source of antibacterial, antioxidant, and cytotoxic agents.
Skrining Bakteri Simbion pada Lalat Buah (Drosophilla melanogaster) sebagai Kandidat Penghasil Senyawa Antibiotika Armini Syamsidi; Arni Fitriyanti
Journal of Tropical Pharmacy and Chemistry Vol. 2 No. 5 (2014): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v2i5.80

Abstract

Now the emergence of bacterial resistance to antibiotics is a national and global issues that have a significant impact on public health. We report the screening of bacterial symbionts in fruit flies (Drosophilla melanogaster) as a producer of new antibiotic compounds. This study aims to get antibiotic-producing bacterial symbionts in fruit flies (Drosophilla melanogaster). In this study used methods of isolation, purification and antibacterial testing using four test bacteria (Escherichia coli, Staphylococcus aureus, Bacillus subtilis, and Salmonella thyposa). Isolation of fruit flies (Drosophilla melanogaster) that uses peptone solution prepared dilutions to 10-9 and then purification is done by scraping the bacteria on NA medium by repeatedly to obtain pure isolates and subsequently antibacterial test. The results showed that the bacterial isolation 10-8 and 10-9 dilutions allegedly produce antibiotic-producing compound while the antibacterial test using test bacteria showed that the compound obtained from the insulation in the fruit fly (Drosophilla melanogaster) showed the compound to inhibit the growth of bacteria Escherichia coli and Staphylococcus aureus. Keywords: fruit flies, Drosophilla melanogaster, antibiotics ABSTRAK Munculnya resistensi bakteri terhadap antibiotika saat ini merupakan masalah nasional dan global yang memiliki dampak signifikan bagi kesehatan masyarakat. Telah dilakukan penelitian mengenai skrining bakteri simbion pada lalat buah (Drosophilla melanogaster) sebagai penghasil senyawa antibiotika baru. Penelitian ini bertujuan untuk mendapatkan bakteri simbion penghasil antibiotika pada lalat buah (Drosophilla melanogaster). Pada penelitian ini digunakan metode isolasi, pemurnian dan pengujian antibakteri dengan menggunakan 4 bakteri uji (Escherchia coli, Staphylococcus aureus, Bacillus subtilis, dan Salmonella thyposa). Isolasi lalat buah (Drosophilla melanogaster) yang menggunakan larutan pepton yang dibuat pengenceran sampai 10-9 kemudian pemurnian yang dilakukan dengan menggoreskan bakteri pada medium NA dengan berulang kali sampai mendapatkan isolat murni dan selanjutnya dilakukan uji antibakteri. Hasil isolasi bakteri memperlihatkan bahwa pada pengenceran 10-8 dan 10-9 diduga menghasilkan senyawa penghasil antibiotika sedangkan pada uji antibakteri dengan menggunakan bakteri uji memperlihatkan bahwa senyawa yang diperoleh dari hasil isolasi pada lalat buah (Drosophilla melanogaster) memperlihatkan senyawa tersebut dapat menghambat pertumbuhan bakteri Escherchia coli dan Staphylococcus aureus. Kata kunci: lalat buah, Drosophilla melanogaster, antibiotika
Primer Design and Analysis for Detection of mecA gene Armini Syamsidi; Nuur Aanisah; Reyhan Fiqram; Imanuel Al Jultri
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.297

Abstract

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ?3, stability ?1,2, secondary structure >-16 Kcal/mol, runs ?5, repeats ?4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method