Claim Missing Document
Check
Articles

Found 9 Documents
Search

In-vitro Sun Protecting Factor of Rice Bran Oil and Its Formulation as Compact Powder Armini Syamsidi; Evi Sulastri; Yusriadi Yusriadi; Pramita Putri; Nuur Aanisah
Jurnal Sains Farmasi & Klinis Vol 10, No 1 (2023): J Sains Farm Klin 10(1), April 2023
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.10.1.54-61.2023

Abstract

This study aims to determine the effective concentration of rice bran oil which can protect against ultraviolet (UV) rays as well as formulate it in compact powder preparation followed by determination of its Sun Protecting Factor (SPF) value. Rice bran samples were extracted using the Soxhlet extraction method with n-hexane: ethanol (1:1) as the solvent. Further identification of the γ-oryzanol in rice bran oil was carried out using TLC silica gel GF254 with eluent of n-hexane:ethyl acetate (3:1). The obtained γ-oryzanol in rice bran oil was used as the ingredient to develop the compact powder which is made into five formulas with 0,05 %-0,25 % concentration. All formulas were characterized, including homogeneity, adhesion and crack test. UV-Visible spectrophotometry was used to determine the SPF value of rice bran oil and its compact powder. The identification results demonstrated a positive presence of the chemical γ-oryzanol in the rice bran oil. At concentrations of 500, 1000, 1500, 2000, and 2500 ppm, rice bran oil may protect against UV rays with SPF values ranging from 1.741 to 11.884. The result showed that all formulas dispersed homogeneously, performed well in terms of compactness, and had no breaks or cracks discovered. Meanwhile, the SPF values of all formulas are found to be 1.390 and 1.274. The results indicate that the SPF values are shallow and are included in the minimal SPF category (2-4) in protecting against UV rays.
Development and Evaluation of Microemulsion-Based Sunscreen Cream Containing Lycopene from Tomato (Solanum lycopersicum L.) Ritha Pratiwi; Nandiska Maladjili; Evi Sulastri; Yusriadi Yusriadi; Nuur Aanisah; Armini Syamsidi
Jurnal Farmasi Sains dan Komunitas (Journal of Pharmaceutical Sciences and Community) Vol 20, No 1 (2023)
Publisher : Sanata Dharma University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24071/jpsc.003807

Abstract

This study aimed to formulate and determine the sun protection factor (SPF) of sunscreen made from tomato lycopene microemulsion creams. Lycopene was used as the active ingredient with varying concentrations in each formula, namely F1 5%, F2 7.5%, and F3 9%. The preparation of each formula was evaluated by conducting the globule size, polydisperse index, organoleptic test, homogeneity test, pH test, spreadability test, viscosity test, and determination of SPF value. The average globule size was 119 nm which had a uniform size distribution. The physical characteristics test of the cream preparations showed the three had a bright yellow color and lacked odor. The pH test results were 3.2 ± 0.12, 5.54 ± 0.25, 6.48 ± 0.22 for F1, F2, F3, respectively. Viscosity test results were F1 40,893.33 cPs, F2 41,746.67 cPs, and F3 43,106.67 cPs. The values obtained from the dispersion test were F1 6.71±0.63, F2 5.58±0.15, and F3 4.81±0.11. Moreover, F3 with a concentration of 9% tomato lycopene microemulsion met the acceptance criteria for all of the physical properties including low viscosity to promote good spreadability, pH that does not irritate the skin, aesthetic appeal, small particle size, and non-odorous and an SPF value of 4.9. The obtained microemulsion-based sunscreen cream exhibited a good physical property of lycopene besides showing sufficient SPF value.
Primer Design and Analysis for Detection of mecA gene Armini Syamsidi; Nuur Aanisah; Reyhan Fiqram; Imanuel Al Jultri
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.297

Abstract

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ?3, stability ?1,2, secondary structure >-16 Kcal/mol, runs ?5, repeats ?4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method
Pemanfaatan Ekstrak Buah Kaktus (Oputian elatior Mill.) sebagai Pewarna Alami pada Sediaan Lipstik Nuur Aanisah; Evi Sulastri; Yusriadi Yusriadi; Friskilla Friskilla; Armini Syamsidi
Jurnal Sains dan Kesehatan Vol. 2 No. 4 (2020): J. Sains Kes.
Publisher : Fakultas Farmasi, Universitas Mulawarman, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Cactus fruit (Opuntia elatior Mill) is a flowering plant of the Cartacae family, which grows in high and dry plateau known to contain betacyanin compound, which is a natural dye of red color. The aim of this research is to identify the physical and chemical characteristics of betacyanin extract of cactus fruit on lipstick ingredients. The examination of physical and chemical characteristics includes organoleptic testing, homogeneity, melting point, pH, lipstick smearing, lipstick hardness and betacyanin levels in the lipstick. Observations were made on the first day and the seventh day of storage. The test results show red lipstick ingredients with a distinctive aroma of the betacyanin extract and densely dispersed homogenous texture. Meanwhile, the melting point test showed lipsticks melt at the temperature of 70°C, with pH value of the first day is 5,86 and the seventh day that is 6,13, polishing evenly and obtained lipstick 90g lipstick hardness level. The result of betacyanin content on the first day is 0.195 mg / 100gram, and on the seventh day is 0.105 mg / 100gram. In conclusion, lipstick produce with betacyanin extract of cactus fruit has good physical stability in accordance with SNI 16-4769-1998 about the ingredients of lipstick (Indonesian National Standard).
In-vitro Sun Protecting Factor of Rice Bran Oil and Its Formulation as Compact Powder Syamsidi, Armini; Sulastri, Evi; Yusriadi, Yusriadi; Putri, Pramita; Aanisah, Nuur
JSFK (Jurnal Sains Farmasi & Klinis) Vol 10 No 1 (2023): J Sains Farm Klin 10(1), April 2023
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.10.1.54-61.2023

Abstract

This study aims to determine the effective concentration of rice bran oil which can protect against ultraviolet (UV) rays as well as formulate it in compact powder preparation followed by determination of its Sun Protecting Factor (SPF) value. Rice bran samples were extracted using the Soxhlet extraction method with n-hexane: ethanol (1:1) as the solvent. Further identification of the γ-oryzanol in rice bran oil was carried out using TLC silica gel GF254 with eluent of n-hexane:ethyl acetate (3:1). The obtained γ-oryzanol in rice bran oil was used as the ingredient to develop the compact powder which is made into five formulas with 0,05 %-0,25 % concentration. All formulas were characterized, including homogeneity, adhesion and crack test. UV-Visible spectrophotometry was used to determine the SPF value of rice bran oil and its compact powder. The identification results demonstrated a positive presence of the chemical γ-oryzanol in the rice bran oil. At concentrations of 500, 1000, 1500, 2000, and 2500 ppm, rice bran oil may protect against UV rays with SPF values ranging from 1.741 to 11.884. The result showed that all formulas dispersed homogeneously, performed well in terms of compactness, and had no breaks or cracks discovered. Meanwhile, the SPF values of all formulas are found to be 1.390 and 1.274. The results indicate that the SPF values are shallow and are included in the minimal SPF category (2-4) in protecting against UV rays.
Sosialisasi Penggunaan Kosmetik Aman Bagi Generasi- Z di Lab School Palu sebagai paya Mencegah Dampak Negatif Produk Ilegal Sejak Dini Sulaiman , Sri Sulistiana; Sulastri, Evi; Syamsidi, Armini; Sultan, Asriana; Sharon, Nela; Aanisah, Nuur
Jurnal Pengabdian Masyarakat Bangsa Vol. 3 No. 7 (2025): September
Publisher : Amirul Bangun Bangsa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59837/jpmba.v3i7.3118

Abstract

Kegiatan pengabdian masyarakat dengan tema Sosialisasi Penggunaan Kosmetik Aman bagi Generasi-Z di Lab School Palu sebagai Upaya Mencegah Dampak Negatif Produk Ilegal Sejak Dini” telah dilaksanakan pada 6 Agustus 2025 dan diikuti oleh 40 siswa kelas XII. Kegiatan ini bertujuan meningkatkan literasi kosmetik aman, membekali peserta agar mampu membedakan produk legal dan ilegal, memahami dampak kesehatan dari kosmetik berbahaya, serta memperkenalkan cara praktis memeriksa legalitas produk dengan mengecek nomor izin edar kosmetik melalui situs maupun aplikasi resmi BPOM. Metode pelaksanaan mencakup survei awal, koordinasi dengan mitra kegiatan, penyusunan media edukasi berupa leaflet, pemaparan materi, simulasi interaktif, serta evaluasi melalui pretest dan posttest. Hasil kegiatan menunjukkan peningkatan kesadaran siswa tentang pentingnya menggunakan kosmetik yang aman dan legal serta adanya peningkatan pengetahuan siswa sebesar 22,13% dengan antusiasme tinggi selama pelaksanaan. Hasil ini menegaskan bahwa sosialisasi efektif dalam membangun kesadaran generasi muda terhadap pentingnya memilih kosmetik aman, sekaligus menjadi langkah preventif untuk mencegah dampak negatif produk ilegal sejak dini.
PELATIHAN PEMBUATAN KOSMETIK MOISTURIZING LIPCREAM SEBAGAI UPAYA PENINGKATAN KETERAMPILAN DAN KEWIRAUSAHAAN DI SLB HUNTAP PALU Aanisah, Nuur; Sulastri, Evi; Syamsidi, Armini; Sultan, Asriana; Sulaiman, Sri Sulistiana
Adi Widya : Jurnal Pengabdian Masyarakat Vol 9 No 2 (2025): Adi Widya: Jurnal Pengabdian Masyarakat
Publisher : Lembaga Penelitian dan Pengabdian Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33061/awpm.v9i2.13492

Abstract

Kegiatan pengabdian kepada masyarakat berupa Pelatihan Pembuatan Kosmetik Moisturizing Lipcream sebagai Upaya Peningkatan Keterampilan dan Kewirausahaan bagi Siswa/i di SLB Huntap Palu telah dilaksanakan pada 5 Agustus 2025, dengan melibatkan guru-guru SLB Huntap Palu sebagai peserta. Program ini bertujuan untuk meningkatkan kompetensi guru agar mampu mengajarkan keterampilan pembuatan lipcream kepada siswa, sehingga mereka memperoleh bekal keterampilan praktis sekaligus peluang berwirausaha. Metode pelaksanaan meliputi koordinasi dengan mitra, penyampaian materi dan brosur, demonstrasi, praktik langsung, serta evaluasi menggunakan instrumen pretest dan posttest. Hasil kegiatan menunjukkan adanya peningkatan pengetahuan peserta sebesar 24,67% serta keterampilan yang baik dalam menghasilkan lipcream dengan kualitas tekstur, warna, dan kemampuan melembapkan yang optimal. Peserta juga menunjukkan antusiasme tinggi selama kegiatan berlangsung. Temuan ini menegaskan bahwa program pelatihan efektif dalam meningkatkan pengetahuan dan keterampilan guru, serta membuka peluang di masa depan bagi pengembangan keterampilan siswa berkebutuhan khusus melalui pendampingan para guru yang telah mengikuti pelatihan.
Diversifikasi Produk Sagu (Mie, Keripik, Cookies) sebagai Upaya Peningkatan Kapasitas Usaha Petani di Desa Limboro, Donggala: Diversification of Low-Glycemic Sago Products (Noodles, Chips, and Cookies): Improving the Welfare of Sago Farmers in Limboro Village, Donggala Regency Aanisah, Nuur; Sulastri, Evi; Wanti, Sri; Adjiwiyasa, Anshar Tejo; Djanun, Eulistinah
Jurnal Pengabdian dan Pengembangan Masyarakat Indonesia Vol. 4 No. 2 (2025)
Publisher : Media Publikasi Cendekia Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.56303/jppmi.v4i2.871

Abstract

Program pengabdian masyarakat ini bertujuan untuk meningkatkan kesejahteraan petani sagu di Desa Limboro, Kabupaten Donggala melalui diversifikasi produk pangan berbasis sagu dengan indeks glikemik rendah, meliputi mie, keripik, dan cookies. Tahapan kegiatan meliputi: (1) sosialisasi dan observasi lapangan guna mengidentifikasi permasalahan yang dihadapi masyarakat, (2) pengadaan mesin pengolah sagu otomatis untuk meningkatkan efisiensi dan kapasitas produksi, (3) pelatihan pembuatan produk olahan sagu yang dilaksanakan secara partisipatif bersama masyarakat, (4) pelatihan kewirausahaan dan strategi pemasaran, serta (5) pendampingan pengurusan Sertifikat Produksi Pangan Industri Rumah Tangga (P-IRT) agar produk memenuhi standar keamanan pangan dan dapat dipasarkan lebih luas. Hasil kegiatan menunjukkan adanya peningkatan keterampilan masyarakat dalam memproduksi olahan sagu, pemahaman tentang pengelolaan usaha dan strategi pemasaran, serta kesiapan untuk memasuki pasar formal melalui sertifikasi P-IRT. Kendala teknis seperti kesesuaian formulasi adonan mie sagu dan penerimaan sensorik pada keripik sagu berhasil diatasi melalui modifikasi komposisi bahan tambahan. Inovasi cookies berbahan dasar sagu juga memberikan nilai tambah karena memiliki indeks glikemik lebih rendah dan kandungan pati resisten yang lebih tinggi. Dengan demikian, kegiatan pengabdian ini berkontribusi nyata dalam mendukung peningkatan kesejahteraan petani dan pengrajin sagu di Desa Limboro melalui penguatan kapasitas produksi, inovasi produk, dan keberlanjutan usaha berbasis potensi lokal.
Low Glycemic Index Taro Tuber (Colocasia esculenta L.) Flakes as Alternative Food Product for Diabetes Management Sultan, Asriana; Rinaldi, Rinaldi; Sulaiman, Sri Sulistiana; Aanisah, Nuur; Khumaidi, Akhmad; Bahar, Zulhaerana; Syamsidi, Armini
Sciences of Pharmacy Volume 4 Issue 4
Publisher : ETFLIN

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.58920/sciphar0404402

Abstract

Flakes are a type of instant food product commonly consumed as a breakfast alternative, especially those labelled “low-glycaemic index” can be suitable for individuals with diabetes. Taro tubers (Colocasia esculenta L.) containing high fibre and low fat are among the raw materials that can be processed into instant food. Therefore, this study aimed to develop and determine the glycaemic index (GI) of Taro tuber flakes as an alternative processed food product for individuals with diabetes. Three distinct formulas, namely F1, F2, and F3, were developed with varying drying temperatures of 40 °C, 60 °C, and 80 °C. These were comprehensively evaluated through sensory testing (hedonic and scoring), followed by the analysis of moisture content, ash content, microbial examination, and glycaemic index. The results showed that all three developed formulas F1, F2, and F3 xhibited low glycaemic index values (below 55), along with acceptable moisture and ash content, and were free from Escherichia coli and Salmonella typhi contamination. Among them, F2, which was dried at 60 °C, showed the lowest glycaemic index value of 15.1, indicating its potential to produce a minimal postprandial blood glucose response. Furthermore, F2 received an average hedonic score of 6, which indicates favorable sensory acceptance in terms of taste, color, texture, and aroma. Therefore, F2 was selected as the most suitable formula that can be consumed as an alternative food product to help manage diabetes through low-GI dietary strategies.