cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Kuswanto
Contact Email
rjls@ub.ac.id
Phone
+62341 575825
Journal Mail Official
rjls@ub.ac.id
Editorial Address
Directorate of Research and Community Service, Gedung Layanan Bersama, 7th Floor, Jl. Veteran Malang, Universitas Brawijaya, 65145, Jawa Timur, Indonesia
Location
Kota malang,
Jawa timur
INDONESIA
Research Journal of Life Science
Published by Universitas Brawijaya
ISSN : -     EISSN : 23559926     DOI : https://doi.org/10.21776/ub.rjls
Core Subject : Health, Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Medicine & Pharmacology
Research Journal of Life Science (RJLS) is an open access publishes papers three times a year that emphasize the agriculture, fisheries, animal science, medicine, basic science and food technology. All articles are rigorously reviewed by reviewers. Articles should be created in a language that is easily understood by non-specialist readers in the topic of the article itself, but interested in research. The main objective of RJLS is to provide a platform for the international scholars, academicians and researchers to share the contemporary thoughts and innovations in the field of life science. RJLS aims to promote studies in life science and so become the leading international journals in life science in the world.This journal intends to provide facilities to advance the development and application of interdisciplinary and transdisciplinary research methodologies in life sciences.
Arjuna Subject : Ilmu Pertanian dan Biologi (Semua) - Ilmu Pertanian dan Biologi (Lain-Lain)
Articles 202 Documents
 17   18   19   20   21 
Analysis of Chitinase Enzyme Trichoderma sp. in Degrading Fusarium oxysporum Rosyida, Risya; Martosudiro, Mintarto; Muhibuddin, Anton
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.5

Abstract

The chitinase enzyme in Trichoderma sp. play an important role in pathogen control. This is because chitin is the main component of the fungal cell wall which the chitinase enzyme can degrade. One Trichoderma sp. isolate was obtained (UBPK6) with the highest percentage of inhibition against Fusarium oxysporum, 76.71%. In addition, UBPK6 isolates also showed the highest bromocresol purple reagent test results (indicating the presence of chitinase enzymes). Chitinase enzyme activity was measured for Trichoderma asperellum isolates. The results showed that the optimum incubation period for enzyme production was the 4th day, with an enzyme activity value of 4.05 U/mL. It indicates that this time is the right time for harvesting enzymes. Furthermore, the effect of pH on the chitinase enzyme activity of Trichoderma asperellum fungus. The test results showed that the optimum value was produced at pH 5 with a value of 3.4 U/mL and decreased afterward. The pH five treatment was the best in inhibiting the growth of pathogens, with an inhibition value of 60.63%. The higher the content of the chitinase enzyme, the higher its ability to degrade damage to the germination of pathogenic spores, thus causing the growth of the pathogen to be inhibited.
Induction Resistance in Chili (Capsicum frutescens L.) to the Geminivirus Disease by Pseudomonas fluorescens Saidi, Aluna Uthilma; Martosudiro, Mintarto; Abadi, Abdul Latief
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.1

Abstract

This study included resistance induced by Pseudomonas fluorescens PGPR in chili (Capsicum frutescens L.) infected with Geminivirus. Geminivirus often attacks chili plants, causing disease with a yellowish color to the leaves, lobes, and stunting. Chili plants that have been attacked by the virus will experience crop failure and plant death. Virus prevention can be done with the application of PGPR by Pseudomonas fluorescens. The method used was 6 treatments on chili plants which were repeated 4 times. The analysis of variance was processed using R software. The results showed that cayenne pepper plants that were given the PGPR application had a shorter incubation period against Geminivirus attacks. Each concentration of Pseudomonas fluorescens has a mean incubation period that is not significantly different. The results also showed that there was a significant difference in the intensity of the disease that attacked the cayenne pepper plant. The application of 107 Pseudomonas fluorescens showed the most optimal results for phenol content, plant height, and number of plant leaves. The application of 109 Pseudomonas fluorescens showed optimal results for the content of IAA and the content of the peroxidase enzyme.
Yield and Yield Components of Red Onion (Allium ascalonicum L.) Influenced by Application of Amino Acid Fertilizer And Triacontanol Putra, Anggara Ista; Waluyo, Budi; Nihayati, Ellis
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.1

Abstract

Red onions are one of the agricultural products with a relatively high demand for the consumer market in Indonesia, but the productivity figure is quite low when compared to other countries (FAO, 2021). This study seeks to explore the effectiveness of the application of amino acid fertilizer and triacontanol in increasing the yield and yield components of red onions. The study took place in Karangploso District, Malang from April to August 2021. Employing a randomized block design, this study used 2 factors, which are amino acid fertilizers (A1: 1000 ppm; A2: 3000 ppm; A3: 5000 ppm) and triacontanol (T0: 0 ppm; T1: 5ppm; T2: 10 ppm). Each combination is repeated 3 times. As a results, amino acid fertilizers can significantly affect the number of red onions bulbs, yields per hectare, economic weight, and economic weight loss. A significant result was seen in the application of triacontanol on red onions yields per hectare and economic weight. The interaction of characters of bulb length was shown in the combination of 5-10 ppm triacontanol with amino acid fertilizer. The best response, which ranged from 10.64% to 11.67%, was noted in fertilizer with 5000 ppm of an amino acid fertilizer. As the concentration of amino acid fertilizer in combination with triacontanol increased, the total bulb fresh weight increased as well, in which, 5000 ppm of amino acid fertilizer could increase the weight by 45,23-45,43 g clump-1, which was greater than the response of the 1000 ppm amino acid fertilizer combination.   
Population Dynamic and Distribution of Bactrocera carambolae and Bactrocera dorsalis in Orchard Habitat in Different Geographical Areas Kolopaking, Budiarto; Rizali, Akhmad; Affandi, Aminuddin; Hudiwaku, Syarron; Himawan, Toto
Research Journal of Life Science Vol 10, No 1 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.01.1

Abstract

Fruitflies, particularly Bactrocera carambolae and Bactrocera dorsalis, are significant pests that have the potential to diminish the quality and quantity of agricultural products. They may live in diverse habitats, particularly in agroecosystem habitats. Orchard habitats offer a source of food and development for fruit flies like B. carambolae and B. dorsalis not only in Java, notably Majalengka Regency, but also in Lombok Island and West Nusa Tenggara. Consequently, the purpose of there search is to observe (1) The population dynamic of B. carambolae and B. dorsalis in the orchard habitat. (2) Distribution of fruit flies B. carambolae and B. dorsalis trapping results in the orchard habitat. (3) Analyzing the factors affecting the presence of the fruit fly species B. carambolae and B. dorsalis in the orchard habitat. Fruitflies were sampled using the trap method between December 2021 and March 2022. In the orchard habitat on the mangosteen fruit commodity, the results indicated that B. carambolae and B. dorsalis had the largest population densities. Additionally, orchard locations on Lombok Island had the highest population density. Furthermore, fruitflies are more prevalent in perennial crops than in annual ones due to higher population density. Perennial crops are the ideal conditions for fruit fly development as compared to seasonal crops.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Ma'alifah, Nur; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrilia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 2 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.
Fourier Transform Infra-Red (FTIR) Spectrum Characterization of Bacillus mycoides Trisnawati, Luh Putu Adi; Aini, Luqman Qurata; Abadi, Abdul Latief; Prillianti, Kestrillia Rega; Prabowo, Matheus Randy
Research Journal of Life Science Vol 9, No 3 (2022)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.03.2

Abstract

The presence of Bacillus mycoides and its ability to grow and spread quickly certainly affect the growth of the target pathogen and it can cause invalid detection results. Therefore, the presence of contaminant bacteria needs to be detected to ensure the specificity of the detection results against the target pathogenic bacteria. Various kinds of detection methods are commonly used, such as ELISA (enzyme-linked immunosorbent assay) and PCR (polymerase chain reaction) are time-consuming and not always very specific. Fourier-transform infrared (FTIR) spectroscopy methods were adopted to provide a comprehensive and reliable method for bacterial analysis. In this study, FTIR spectroscopy was used as an initial guess for the identification of bacterial isolates. Our results showed that there are dominant peaks from the FTIR spectrum obtained that were most associated with protein and carbohydrate in the range of wave number 400-4000 cm-1.  
Forecasting Model of Coffee Berry Borer (Hypothenemus Hampei) in Pasuruan District Nadiah, Annisrien; Himawan, Toto; Tarno, Hagus
Research Journal of Life Science Vol 10, No 1 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.01.2

Abstract

Coffee, a globally important commodity, faces difficulties in Indonesia due to pests that reduce its quality and productivity. The coffee berry borer (Hypothenemus hampei) is particularly dangerous, causing hollowed-out coffee seeds and causing massive annual losses worldwide and in Indonesia. Factors such as climate, weather, and other environmental aspects play a pivotal role in influencing pest lifecycles, emphasizing the necessity of understanding the intricate relationship between pests and their environment for effective management. This research aims to contribute to minimizing coffee production losses and harvest failures resulting from H. hampei infestations. This study relies on secondary data from the BBPPTP in Surabaya and NASA. Using panel data regression analysis, the study discovers that coffee berry borer attacks in the Pasuruan District follow a seasonal pattern. Furthermore, with a forecasting accuracy of 15.94%, the model reveals that air humidity, temperature, and previous attacks are the dominant variables influencing current coffee berry borer attacks. The developed model provides a reliable tool for forecasting coffee berry borer attacks, with humidity and previous month's attacks emerging as the most influential factors, particularly in the Pasuruan District of East Java.
The Influence of Seed Biopriming with Rhizobacteria on The Control of Black Rot Disease by Xanthomonas campestris Pathogens Rahman, Fakih Nur; Aini, Luqman Qurata; Syib`li, Muhammad Akhid
Research Journal of Life Science Vol 10, No 3 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.03.2

Abstract

The use of chemical pesticides in agriculture has negative impacts on the environment and health and leads to pathogen resistance. As an alternative, microorganisms such as PGPR or PGPF can enhance plant resilience and growth. Biopriming can trigger systemic resistance, improve nutrient uptake, and protect plants from pathogen infection. This study aims to evaluate the potential of biopriming and the effects of rhizobacterial application on plants. There are three main tests: the pathogenicity test of Xanthomonas campestris, the rhizobacterial test on cabbage seeds and seedlings, and the effectiveness of rhizobacteria in suppressing black rot disease in cabbage. Rhizobacterial application increased peroxidase enzyme and total phenol levels in plants, as well as plant height and leaf number. Rhizobacteria also improved cabbage seed germination and suppressed plant diseases. In conclusion, all tested rhizobacteria induced resistance in cabbage plants by increasing peroxidase enzyme and total phenol levels. Rhizobacterium TO9 (Clostridium sp.) was the most effective in enhancing plant resistance. Rhizobacteria also stimulated cabbage growth. Further research is needed to understand the mechanisms and effectiveness of rhizobacteria under different agricultural conditions.
Antifungal activity of clove (Eugenia caryophyllata) extract against Fusarium oxysporum cutinase enzyme in Tomato (Solanum lycopersicum) from in vitro study Khairunnisa', Amalia; Syib’li, Muhammad Akhid; Abadi, Abdul Latief
Research Journal of Life Science Vol 10, No 2 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.02.3

Abstract

Fusarium oxysporum f.sp. lycopersici presents a notable threat to tomato plants due to the hydrolytic activity of its cutinase enzyme, which facilitates the penetration of plant root tissues. Thus, reducing cutinase activity through the application of cloves as inhibitors offers an environmentally friendly alternative to hazardous chemical fungicides, showing great promise in controlling Fusarium wilt disease, particularly by targeting the cutinase enzyme of Fusarium oxysporum. This study involved GC-MS analysis of clove extract, fungal growth and cutinase activity assay using rhodamine-b olive oil media. Hence, this study aims to reveal the potential and mechanism of clove extracts as inhibitors of cutinase enzymes to reduce the penetration of the Fusarium oxysporum pathogen in tomato plants. The result shows that clove extract, containing approximately 20% antifungal compounds primarily eugenol (11% of total peak area), inhibits Fusarium oxysporum growth. It also reduces the hydrolytic activity of cutinase crucial for fungal penetration, evidenced by decreased fluorescence halos in tests with rhodamine-B and olive oil media under UV light after adding 1%, 2%, and 3% clove extract. Further in vivo studies are needed to explore its direct effects as a plant inhibitor.
Comparison of Primer Types to Produce Fungal DNA Fragment from Garlic Plant Root Samples Dewi, Fibrianti Shinta; Abadi, Abdul Latief; Syib'li, Muhammad Akhid
Research Journal of Life Science Vol 10, No 3 (2023)
Publisher : Direktorat Riset dan Pengabdian Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2023.010.03.3

Abstract

Fusarium wilt disease caused by Fusarium oxysporum f.sp cepae is a widespread and dangerous diseases in garlic commodities. The combination of AMF and Bacillus amyloliquefaciens can be an effective solution to reduce losses due to attacks by these pathogens. The PCR technique is initial method that has proven to be significant in detecting fungal target DNA so that the effectiveness of biological agents can be determined. The aim of this study is to compare the types of primers that are effective for use in detecting fungal groups in PCR. This research was conducted in October 2023 - November 2024. The types of primers compared were ITS1-F/ITS4-R and LSU200A-F/LSU476-R with spectophotometry and fluometry quantification. The results show that ITS1-F/ITS4-R forms DNA band with a size of 700 bp, while LSU200A-F/LSU476-R had a size of 290-300 bp. The electropherogram also showed differences in DNA distribution which confirmed the results on agarose more specifically in the range 19-12,999 bp. In general, these results prove that the two types of primers have different abilities in fragmenting target DNA. This knowledge can help in detecting DNA at an early stage which can be used in various analyzes that can help in integrated plant disease management.

Page 19 of 21 | Total Record : 202

 17   18   19   20   21 

Filter by Year

2014 2024


Reset
Filter By Issues
All Issue Vol 11, No 1 (2024) Vol 10, No 3 (2023) Vol 10, No 2 (2023) Vol 10, No 1 (2023) Vol 9, No 3 (2022) Vol 9, No 2 (2022) Vol 9, No 1 (2022) Vol 8, No 3 (2021) Vol 8, No 2 (2021) Vol 8, No 1 (2021) Vol 7, No 3 (2020) Vol 7, No 2 (2020) Vol 7, No 1 (2020) Vol 6, No 3 (2019) Vol 6, No 2 (2019) Vol 6, No 1 (2019) Vol 5, No 3 (2018) Vol 5, No 2 (2018) Vol 5, No 1 (2018) Vol 4, No 3 (2017) Vol 4, No 2 (2017) Vol 4, No 1 (2017) Vol 3, No 3 (2016) Vol 3, No 2 (2016) Vol 3, No 1 (2016) Vol 2, No 3 (2015) Vol 2, No 2 (2015) Vol 2, No 1 (2015) Vol 1, No 1 (2014) More Issue