cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Asep Gunawan
Contact Email
agunawan@apps.ipb.ac.id
Phone
-
Journal Mail Official
jipthp@apps.ipb.ac.id
Editorial Address
-
Location
Kota bogor,
Jawa barat
INDONESIA
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Published by Institut Pertanian Bogor
ISSN : 23032227     EISSN : 2615594X     DOI : -
Core Subject : Health, Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Veterinary
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan receives manuscripts encompass a broad range of research topics : livestock production, management and environment, breeding and genetics, livestock yield technology, and socio-economic livestock.
Arjuna Subject : -
Articles 309 Documents
 21   22   23   24   25 
Analisis Keefektifan Ekoenzim sebagai Pembersih Kandang Ayam dari Limbah Buah Jeruk (Citrus sp.) A. Mahdia; P. A. Safitri; R. F. Setiarini; V. F. A. Maherani; M. N. Ahsani; M. S. Soenarno
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 1 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.1.42-46

Abstract

Sanitation of the cage usually requires a sanitizer containing a powerful cleaning fluid to sterilize the cage. Materials commonly used for cage sanitation are detergent or disinfectants used to eradicate pathogenic microorganisms that cause bacteria, fungi, or other microorganisms. Eco enzyme is an alternative natural cleaning agent derived from fresh fruit waste through fermentation. This study aimed to make eco enzymes for cleaning chicken coops from citrus waste, characterize the microbiological eco enzymes, and test the effectiveness of eco enzymes as chicken coop cleaners. Eco enzymes from fresh citrus waste after a 3-month fermentation period contained bacteria and fungi of 1.9 x 106CFU/ml and 8.5 x 105CFU/ml, respectively, with a pH of 3.39±0.023. The eco enzyme of cage cleaning fluid from citrus waste (Citrus sp.) can inhibit the growth of Escherichia coli and Staphylococcus aureus through confrontation tests in the laboratory. Testing the effectiveness of eco enzymes in chicken coops can reduce the number of bacteria five times more than detergents for the same area.
Identifikasi Komposisi Proksimat Telur Ayam Ras Fermentasi Menggunakan Lactobacillus plantarum dengan Waktu Inkubasi yang Berbeda A. Mangalisu; A. K. Armayanti; I. I. Arief; Z. Wulandari
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 1 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.1.47-50

Abstract

Eggs that have a balanced amino acid content can fullfill protein that needs in humans, However, eggs have a low shelf life so they were easily damaged. Fermentation technology on foodstuffs by using microbes has been widely carried out, among others using Lactobacillus bacteria. The type of Lactobacillus bacteria commonly used in egg fermentation is Lactobacillus plantarum. This study was conducted experimentally by using a completely randomized design (CRD) with 3 treatments and 3 replications each. The treatment was carried out by fermentation with an incubation temperature of 37 oC with different incubation times of 0, 48, and 96 hours with research parameters water content, crude fat, crude fiber, BETN and ash content. The results showed that different incubation time treatments on fermented chicken eggs had a significant effect (P<0.05) on water content, crude fat, crude fiber, BETN and ash content. The nutritional composition of fermented eggs by using L. plantarum could be seen from the decrease in water content, crude fiber and BETN and an increase in crude fat and ash content with increasing incubation time. The value of water content, crude fat, crude fiber, BETN and optimum ash content at an incubation temperature of 37 oC for 96 hours of incubation time.
Persepsi Peternak tentang Ayam IPB D-1 sebagai Ayam Lokal Unggul (Kasus Sinar Harapan Farm Jampang Tengah Sukabumi) L. Cyrilla; C. Sumantri
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.51-56

Abstract

IPB D-1 chickens were produced from research on the application of molecular genetics with the aim of increasing the productivity and quality of Indonesian local chickens. This study aims to determine the perception of farmers at Sinar Harapan Farm Jampang Tengah Sukabumi about IPB D-1 chickens, which is viewed from the characteristics of innovations in IPB D-1 chickens. The research was conducted at Sinar Harapan Farm (SHF) which was located in Jampang Tengah District, Sukabumi Regency. Data collection was carried out in August 2020. Data collection was carried out by interviewing all 18 member farmers of Sinar Harapan Farm. SHF farmers’ perceptions of IPB D-1 chickens were measured from five characteristics of innovations in IPB D-1 chickens which included: relative advantage, compatibility, complexity, trialability, and observability. The results showed that the perception score for the aspect of relative advantage was 4.34, compatibility was 4.38, compatibility was 4.25, trialability was 4.13, and observability was 4.15. The farmers of Sinar Harapan Farm Jampang Tengah Sukabumi showed a good perception about IPB-D1 chickens.
Effectiveness of Water Hyacinth Bioconversion and Fermented Fruit Waste as a Growing Media Larvae of Hermetia illucens Wahyuni; R. C. Fadhlil
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.57-61

Abstract

Black Soldier Fly (BSF) larvae have cellulosic activity in the presence of bacteria in their intestines. Generally, the organisms that play a role in bioconversion process are bacteria, and Hermetia illucens larvae as a bioconversion agent for fermented water hyacinth are combined with fruit waste and used as a growth medium. The purpose of this study was to determine the increase in larva mass weight, feed conversion efficiency, waste reduction index from water hyacinth bioconversion activity and fermented fruit waste by Hermetia illucens larvae. Hermetia illucens larvae are treated with feeding P0 = 100 % fruit waste, P1 = Fruit waste 25 % + 75 % fermented water hyacinth, P2 = 50 % fruit waste + 50 % fermented water hyacinth, and P3 = 75 % fruit waste + 25 % fermented water hyacinth. The larvae used were 6 days old, for all treatments 50 g used. The results showed that P3 = 75 % fruit waste + 25 % fermented water hyacinth produced the highest average final mass weight of larvae, namely 124.62 g, average feed consumption was 72.72 %, average ECD and WRI values were 10.98 % and 10.38 %, respectively. The mixing level of water hyacinth and fermented fruit waste in treatment 3 showed effective results as a medium for the growth of Hermetia illucens larvae.
Review: Tepung Telur Ayam: Nilai Gizi, Sifat Fungsional dan Manfaat Z. Wulandari; I. I. Arief
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.62-68

Abstract

Eggs are an almost perfect source of animal protein. Commercial chicken eggs are a perfect food that contains nutrients such as protein (12.8 %) and fat (11.8 %). In 100 grams of whole eggs also contain vitamin A of 327.0 IU and minerals of 256.0 mg. Eggs contain high-quality protein because they have a complete composition of essential amino acids and have a high biological value, which is 100 %. The high content of water, fat and protein in eggs make this food as a good medium for bacterial growth so that their shelf life is quite short. Drying eggs into powder offers many advantages, including ease of storage, distribution, protection against microbial growth (low water activity), reduced weight per volume of whole eggs, longer shelf life. The use of egg powder as an additive to other food products is easier than using fresh eggs. The purpose of this review is to study the nutritional characteristics, functional properties and benefits of egg flour. The nutritional value and functional properties of egg powder, egg white powder and egg yolk powder can still provide maximum results both for raw material products or as food additives. The use of egg powder will facilitate industry, especially medium and large scale industries in handling, packaging, storage and processing compared to use with fresh eggs.
Hubungan Tingkat Konsumsi Madu dengan Pengetahuan Gizi, Status Gizi, dan Kebugaran Remaja di Kota Bogor A. Septiani; A. Apriantini; T. Suryati
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.69-76

Abstract

Honey consumed regularly is known to improve vitality. The level of vitality can be influenced by several factors, such as the amount of food intake, that related to nutritional knowledge and status. The objectives of this study is to analyze the connection between the knowledge about nutrient, the status of nutrition, and the level of honey consumption to the vitality of adult’s body in Bogor City. Sampling is carried out based on the Slovin formula with a total of 100 respondents and has qualified representatives of adult’s in Bogor City. The status of nutrition measurement by anthropometric method. The data of body vitality level is measured through Balke Test. The data is collected through a questionnaire interview and then descriptively analyzed and tested for the correlation. The results that 69 % of the respondents are lack of knowledge about nutrient. The status of nutrition values is 79 % of them are normal. The highest level of honey consumption is 2 to 3 times a week. The conclusion is the knowledge about nutrient, the status of nutrition, and the level of honey consumption influence the vitality of human body based on the multiple correlation test.
Karakteristik Produksi Cacing Tanah (Lumbricus rubellus) dengan Pakan Limbah Pasar Berupa Sayur Sawi Hijau dan Pepaya S. Liberty; Y. C. Endrawati; Salundik
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.77-85

Abstract

Environmental pollution can be minimized by utilizing traditional market waste through the cultivation of earthworms. Market waste that is commonly found is vegetable and fruit waste. Market waste that is used as feed can minimize the production budget in worm farming. This research used a completely randomized method, four treatments and three replications. The aim of this study was to investigate the effect of feed with mustard green waste and papaya waste on the productivities (body weight and body length) of Lumbricus rubellus, vermicompost production, and that economic value. The results of the study stated that the treatment significantly (P<0.05) affected the parameters of worm body weight, worm body length, and vermicompost production. Papaya waste (P400) treatment produce the highest body weight of L. rubellus in 1.108 ± 0.128 g, body length in 9.367 ± 0.446 cm, and waste degradation in 45.62 %. The papaya waste showed the highest results in terms of body weight gain and body length of L. rubellus. The cultivation of earthworm can provide economic value for Rp 514.428,60/4 months by producing earthworms and vermicompost.
Tingkah Laku Makan Domba Lokal pada Sistem Pemeliharaan Berbeda I. Munandar; M. Yamin; D. A. Astuti; S. Rahayu
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.86-90

Abstract

Sheep is a livestock commodity this is used to meet national meat needs. This response takes a look at goals to look at social conduct and consume nearby sheep, which can be maintained in one of a kind renovation structures and supply one of a kind styles of concentrates. Looking at the 20 sheep used, their initial weight was 16.51 kg. Experiments were conducted throughout random layouts. The first part is device renovation and the second one part is the form of feed listen. The parameters discovered beating, mastication, remastication, regurgitation, length of eating. Data become analyzed with the aid of using evaluation of variance (ANOVA). The consequences of the take a look at confirmed that the form of listen and renovation device affected meals conduct (beating, mastication of remastication and regurgitation, length of eating).
Desain Primer Gen Virulensi invA untuk Identifikasi dan Sekuensing Salmonella pada Sampel Karkas Ayam R. P. Melati; S. Nurjanah; W. P. Rahayu
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.91-97

Abstract

Identification and sequencing of Salmonella require a specific primer as well as a virulence marker. Invasion gene (invA) is a gene found in all types of Salmonella, specific to Salmonella, and has a low mutation rate so that it can be used as a target gene for Salmonella identification. This study aimed to design a primer of invA gene of Salmonella spp. with long amplicons, has broad serovar coverage, and get an optimum PCR condition. Primers were designed and checked its specificity in silico using Primer-BLAST and then selected. Selected primer was evaluated for annealing temperature and primer concentration. Based on the sequential selection, it was obtained a set of invA gene primer with forwarding sequences GCCGGTGAAATTATCGCCAC (started at base 297) and reverses sequences CTCGTAATTCGCCGCCATTG (started at base 1763). Based on Primer-BLAST analysis, the primer gave an amplicon size of 1486 bp, has annealing temperature of 58 °C, capable of detecting at least 110 Salmonella serovars, capable to detect Salmonella contamination in chickens, and unable to detect the presence of Klebsiella sp., Citrobacter sp., Serratia sp., Hafnia sp., and E. coli. This primer can detect Salmonella very well with annealing temperature of 58 oC and primer concentration of 1.2 µM.
Pengaruh Lama Waktu Penurunan Kadar Air terhadap Kualitas Fisikokimia Madu Kapuk dan Madu Rambutan A. Apriantini; Y. C. Endrawati; Z. Astarini
Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan
Publisher : Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with Animal Scientist's Society of Indonesia (HILPI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jipthp.10.2.98-104

Abstract

Honey is a livestock product that has high nutritional content and beneficial for the health of human body, but Improper post-harvest handling can cause short shelf life. The aim of this study was to analyze the physicochemical quality of kapok honey and rambutan honey after moisture reduction treatment using a dehumidifier. The kapok and rambutan honey samples had three different duration of moisture reduction treatments, included 0 hours, 4 hours, and 8 hours at room temperature ±30 °C. Each treatment level was repeated four times. This study used descriptive analysis. The physicochemical analysis during the treatment consists of water content, pH, ash content, viscosity, color, and sugar content. The results showed that the treatment of honey for 8 hours at a temperature of ±30 °C had a water content that was close to the SNI standard. Moreover, the nutritional content of honey in the 8-hour treatment of moisture reduction had the best results in the physicochemical quality both of kapok honey and rambutan honey even though the treatment did not affect the ash content of rambutan honey and the pH value of the two types of honey. The moisture reduction did not reduce the physicochemical quality in 2 types of honey.

Page 23 of 31 | Total Record : 309

 21   22   23   24   25 

Filter by Year

2013 2025


Reset
Filter By Issues
All Issue Vol. 13 No. 3 (2025): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 13 No. 2 (2025): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 13 No. 1 (2025): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 12 No. 3 (2024): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 12 No. 2 (2024): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 12 No. 1 (2024): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 11 No. 3 (2023): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 11 No. 2 (2023): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 11 No. 1 (2023): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 3 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 2 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 10 No. 1 (2022): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 9 No. 3 (2021): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 9 No. 2 (2021): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 9 No. 1 (2021): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 8 No. 3 (2020): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 8 No. 2 (2020): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 8 No. 1 (2020): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 7 No. 3 (2019): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 7 No. 2 (2019): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 7 No. 1 (2019): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 6 No. 3 (2018): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 6 No. 2 (2018): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 6 No. 1 (2018): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 5 No. 3 (2017): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 5 No. 2 (2017): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 5 No. 1 (2017): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 4 No. 3 (2016): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 4 No. 2 (2016): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 4 No. 1 (2016): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 3 No. 3 (2015): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 3 No. 2 (2015): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 3 No. 1 (2015): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 2 No. 1 (2014): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 1 No. 3 (2013): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 1 No. 2 (2013): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan Vol. 1 No. 1 (2013): Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan More Issue